ID: 962935512

View in Genome Browser
Species Human (GRCh38)
Location 3:140076947-140076969
Sequence CCCGCCCAGGCACTGTGCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 168}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962935509_962935512 12 Left 962935509 3:140076912-140076934 CCTTGCACGGTGGGATGCTCAGC 0: 1
1: 0
2: 0
3: 19
4: 220
Right 962935512 3:140076947-140076969 CCCGCCCAGGCACTGTGCTTTGG 0: 1
1: 0
2: 3
3: 25
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962935512 Original CRISPR CCCGCCCAGGCACTGTGCTT TGG Intronic
900148226 1:1167458-1167480 CCCGCCCAGGCGCTGTGGGCAGG - Intergenic
900374855 1:2349054-2349076 CCCCCTCAGGCCCTGTGCTTGGG + Intronic
900486576 1:2925478-2925500 CCCGCCCAGCCACGGTTCCTGGG + Intergenic
900676544 1:3890741-3890763 CCGGACCCGGCACTGTGTTTTGG + Exonic
900906761 1:5564719-5564741 TCCTTCCAGCCACTGTGCTTGGG + Intergenic
900966580 1:5962861-5962883 GCAGCCCAGGCCCTGTGTTTCGG - Intronic
901012602 1:6210021-6210043 CCTGCCCAGGCTCTGAGCTGAGG - Intronic
902834640 1:19038639-19038661 CCCGCCCAGACACTGAGGGTGGG + Intergenic
903325359 1:22565954-22565976 CCAGCCCAGGGACAGTGCTGGGG - Intronic
903726241 1:25447896-25447918 CCCACCCAGGCCTGGTGCTTTGG + Intronic
904822455 1:33255101-33255123 CTGTGCCAGGCACTGTGCTTGGG + Intergenic
907427291 1:54388423-54388445 CCAGGCCAGGCACTGTGTGTGGG - Intronic
907809233 1:57851978-57852000 CACGCCAAGGCACTATGCTTTGG - Intronic
910265419 1:85332625-85332647 GGCCCCCAGGCAATGTGCTTGGG - Intronic
911041286 1:93592822-93592844 CCAGCCCAAGGACTGTGCTTTGG - Intronic
912532897 1:110339302-110339324 CCCGCCCAACCACTGTTATTGGG - Exonic
912595774 1:110874358-110874380 TGAGGCCAGGCACTGTGCTTTGG + Intronic
914913063 1:151802110-151802132 CTAGGCCAGGCACTGTGCTGAGG + Exonic
915095077 1:153456870-153456892 CCAGGCCAGGCAGTGTGCTATGG - Intergenic
916746356 1:167687714-167687736 CCCTTCCTGGCACTGTGCATTGG - Intronic
920558001 1:206918312-206918334 CTAGCCCAGGCCCTGTGCCTTGG + Intronic
920667335 1:207972605-207972627 CTCGTCCAGTCACTGTGCTTGGG + Intergenic
920926730 1:210348533-210348555 ACATCCCAGGCACTGTGCTAGGG + Intronic
923500678 1:234561143-234561165 CCCACACAGGCCCTGTGCTTGGG + Intergenic
923525565 1:234770070-234770092 CCCACCCAGGCTCGGTGCTCGGG - Intergenic
924402903 1:243706749-243706771 CTCAGCCAGGCACTGTGCTCAGG + Intronic
924457434 1:244230009-244230031 CCCAGCCAAGCTCTGTGCTTTGG - Intergenic
1067430594 10:46240945-46240967 GGCCCCCAGGCAGTGTGCTTGGG - Intergenic
1069705844 10:70458704-70458726 CCTGCCCAGGCCCTGTGGTCGGG + Intergenic
1069785713 10:70986577-70986599 CCAGCCCTGACACTGTGCTTGGG - Intergenic
1070592465 10:77810768-77810790 CCCGGCCAGGCCCTGGGCTCTGG - Intronic
1072543064 10:96413126-96413148 CCAGCATAGGGACTGTGCTTTGG + Intronic
1072578280 10:96719869-96719891 CCCTCCCAGGCTTTGTGTTTTGG - Intronic
1073150733 10:101309818-101309840 GCCTCCCAGGCTCTGTGCTGAGG + Intergenic
1077271321 11:1683428-1683450 CCCGCTCCGGCACTGGGATTTGG - Intergenic
1079377167 11:19903769-19903791 CATTCTCAGGCACTGTGCTTGGG + Intronic
1081614202 11:44580900-44580922 CCTCCCCAGGCACTGAGCTCAGG - Intronic
1083731759 11:64656100-64656122 CCCGCCCAGGCCCTGTGGGTTGG + Intronic
1084572911 11:69970276-69970298 AGAGCCCAGGCACTGTGCTTCGG + Intergenic
1086549795 11:88042543-88042565 CTTCCCCAGGCACTGTGCCTGGG - Intergenic
1086972672 11:93100387-93100409 CCCATGCAGGCCCTGTGCTTGGG + Intergenic
1087300912 11:96434046-96434068 CCCTCCTAGGCTCTGTGCTTGGG + Intronic
1089401760 11:118168489-118168511 CCGGCCCCGGCACTGCGCTAGGG - Intronic
1092230880 12:6774667-6774689 ACCGCCCAGCCTCTGTGCATTGG + Exonic
1092262942 12:6962201-6962223 CACGCCCAGCCTCTGGGCTTTGG - Intergenic
1098015841 12:66103703-66103725 CCCACCCCCGCACTGGGCTTGGG + Intergenic
1101086513 12:101241812-101241834 CCTGCCCAGGCCATGTGTTTTGG + Intergenic
1104715670 12:131014523-131014545 CCAGCCCAGGCACTATGCGAGGG - Intronic
1105356307 13:19663192-19663214 CACTGCCAGGCACTGTGCTGGGG + Intronic
1106209053 13:27624097-27624119 CCCGCCAGTGCTCTGTGCTTTGG + Intronic
1106809817 13:33349355-33349377 ACTGCCCAGGAACTGTGCTGTGG + Intronic
1107446340 13:40473074-40473096 GCCTCCCAGGTACTGTGATTGGG - Intergenic
1107758168 13:43648291-43648313 ACAGCCCAGACACTGTTCTTTGG + Intronic
1108509888 13:51147127-51147149 CCCTCCCAGGTACTCTGCTGGGG + Intergenic
1112196816 13:97234483-97234505 CCCGCCCCCGCACTGTGCTCAGG - Intronic
1112362171 13:98728064-98728086 CTGGTCCAGGCAGTGTGCTTTGG + Intronic
1113415588 13:110126054-110126076 CCGTCTCAGGCACTGTGCTGGGG + Intergenic
1118775073 14:68968842-68968864 CCAGCCCTGGTACTGTGCTTTGG - Intronic
1121521908 14:94591881-94591903 CTGCCCCAGGCACTGTGCTGGGG - Intronic
1122650201 14:103221773-103221795 GCCTCCCAGGTGCTGTGCTTGGG + Intergenic
1125796303 15:42406470-42406492 ACATTCCAGGCACTGTGCTTGGG + Intronic
1126581482 15:50246186-50246208 CCACCCCAGGCACTGTGCTAAGG + Intronic
1127836974 15:62797830-62797852 CCTGCCCAGGCACGGGGCTGTGG + Intronic
1127995761 15:64152377-64152399 CCCGCCCAGGCCCTGTGAGGCGG + Intronic
1128183681 15:65626122-65626144 CTCTGCCAGGCACTGTGCTGGGG + Intronic
1129109206 15:73327926-73327948 CTGTCCCAGGCACTGTCCTTTGG - Intronic
1129875695 15:78973933-78973955 CCCACCTAAGCACTGGGCTTGGG + Intronic
1132931788 16:2462426-2462448 CCAGCCCAGGCTCAGTGCTGTGG + Exonic
1134016053 16:10889203-10889225 CCCGCTCTGGCAATGTGGTTTGG + Intronic
1136541954 16:30932666-30932688 ACCCTCCAGGCACTGTGCTGCGG - Intronic
1138270263 16:55691058-55691080 CCTTCCTAGGCAATGTGCTTAGG + Intronic
1138444222 16:57053381-57053403 CCCTGCCAGTCACTGTGCTCTGG - Intronic
1139953549 16:70683056-70683078 CCAGAGCAGCCACTGTGCTTGGG - Intronic
1141767946 16:86071079-86071101 CTTGACCGGGCACTGTGCTTTGG - Intergenic
1142249646 16:88985524-88985546 CCCACCCAGGATCTGTGCGTGGG + Intergenic
1142313844 16:89330642-89330664 CCCCCCCAGTCACTGTACTGGGG - Intronic
1142346530 16:89557587-89557609 CAGGCCCAGGCACTGGGCTCCGG + Exonic
1143106139 17:4531455-4531477 CCAGCCCTGGCGCTGTGCTAGGG + Intronic
1143449023 17:7024619-7024641 CCCGACCAGGCTCCCTGCTTGGG - Exonic
1144590247 17:16517628-16517650 CCCTCCCACTCACTGTGCTGGGG + Intergenic
1147167175 17:38599773-38599795 CCCACGCATGCACTGGGCTTGGG - Intronic
1148552914 17:48561241-48561263 CCCTGCCAGGCACTGGGCTAAGG - Intronic
1150806334 17:68322232-68322254 CCCACCAAGGTGCTGTGCTTGGG + Intronic
1151296374 17:73189489-73189511 CCGGGCCAGGCACTGTGCCGGGG - Intergenic
1152515546 17:80821679-80821701 CGCGCCCAGGCCCTGTCCTAAGG - Intronic
1154105336 18:11517994-11518016 GCAGCCCAGGCACAGTGTTTTGG + Intergenic
1154376099 18:13811239-13811261 ACCGCCCAGGCACACAGCTTGGG - Intergenic
1155095421 18:22550600-22550622 CTGTCCCAGGCACTGTGCTGAGG - Intergenic
1156822785 18:41392801-41392823 CAGGTCCAGGCACTTTGCTTTGG + Intergenic
1157407532 18:47435457-47435479 TTCGTCCAGGCACTGTGCTAGGG + Intergenic
1158405821 18:57158249-57158271 CCCTCCCAGGCAGTTTTCTTGGG - Intergenic
1160747855 19:720166-720188 CCCGCCCCCGGCCTGTGCTTGGG - Intronic
1161331215 19:3688616-3688638 CCCCCCCAGGCATTGTCCTCAGG + Intronic
1161436911 19:4268926-4268948 CCCCACCTGTCACTGTGCTTAGG + Exonic
1161616065 19:5270924-5270946 CTCCCTCAGGCCCTGTGCTTTGG - Intronic
1162487564 19:10970661-10970683 CCTCCCAAAGCACTGTGCTTAGG + Intronic
1162790303 19:13059353-13059375 CCTCCCCAGGCCCTGTGCTGGGG - Intronic
1162986989 19:14277312-14277334 CCGGGCCAGGCCCTGTGCCTGGG + Intergenic
1164447110 19:28327357-28327379 CCCGCCCAGGCACAGTGGGAGGG - Intergenic
1164627930 19:29741654-29741676 CCAGACCAGGGACTGTCCTTAGG - Intergenic
1165165226 19:33849379-33849401 CCTGCCCTGGCACTGTACTGAGG + Intergenic
1165521118 19:36314762-36314784 TCCTCCCAGGGACTGTCCTTAGG - Intergenic
1165533360 19:36422191-36422213 AAGGCCCAGGCACTGGGCTTTGG + Intergenic
1165622950 19:37263826-37263848 TCCTCCCAGGGACTGTCCTTAGG + Intergenic
1167232636 19:48294987-48295009 CACGCCCAGCCACTGTTCTAAGG + Intergenic
1168172547 19:54598030-54598052 CCCACCAAGGCTCTGTGCTCAGG + Intronic
932422608 2:71610612-71610634 CCCTCCCCAGCAGTGTGCTTTGG + Intronic
935863281 2:107357850-107357872 CCTGACTAGGCTCTGTGCTTAGG + Intergenic
936227689 2:110672763-110672785 CCCGCCCAGGCAATGTACAGAGG + Exonic
936349189 2:111700036-111700058 TCCGCCCAGCCACTGTCCTGAGG - Intergenic
936556136 2:113499945-113499967 CCCGCCCAGGCCCTCTGCTTGGG + Exonic
937061733 2:118985060-118985082 CTGGGCCAGGCACTGTGCCTGGG + Intronic
938068473 2:128294220-128294242 CCGGCCCTGGCACTGTGCTCTGG + Intronic
939090717 2:137776957-137776979 CCCCGCCAGGCACTCTGCTGAGG - Intergenic
947983594 2:234429887-234429909 CTAGGCCATGCACTGTGCTTTGG + Intergenic
1169251543 20:4064752-4064774 CCCGCCAGGGCACTGGGCTTCGG + Intergenic
1170972697 20:21131123-21131145 TCCTCCCAGGCACTCTTCTTGGG + Intronic
1173434956 20:43024086-43024108 TGCACCCAGGCACTGTGCCTTGG - Intronic
1173548160 20:43914841-43914863 CCCGCCCAGGCACTGCCCGCGGG + Intergenic
1174282582 20:49449995-49450017 CCAACCCAGGAACTGAGCTTGGG - Intronic
1174305011 20:49608900-49608922 CTCTCCCAGGCGCTGTGCTAAGG - Intergenic
1175277924 20:57784422-57784444 AGCCCCCAGGCACTGTGCTGGGG + Intergenic
1179639403 21:42737190-42737212 CTGGCCCAGGCCCTGTGCATCGG - Intronic
1180897261 22:19345765-19345787 CCCAGCCAGGCCCTGTTCTTAGG - Intronic
1181115570 22:20631045-20631067 CACCCCCACGCACTGTGCCTAGG + Intergenic
1183176393 22:36227606-36227628 CCCGCCCAGGCAATGAGCAGAGG - Exonic
1185241363 22:49749339-49749361 CCCACCCAGGCACAGAGCTGTGG + Intergenic
950236621 3:11327144-11327166 GACTCTCAGGCACTGTGCTTAGG + Intronic
950563529 3:13749820-13749842 CACGGCCAGGCACTGTGCTGTGG + Intergenic
951744754 3:25965674-25965696 CCAGCCCAGGCACCGAACTTGGG - Intergenic
952646800 3:35669814-35669836 CCCTTCCAGGCACTTAGCTTAGG + Intronic
953693086 3:45136230-45136252 CCCACCCACACAATGTGCTTTGG - Intronic
955118676 3:56032709-56032731 CCCAACCAGGCACTGTGGTGTGG + Intronic
955955801 3:64288180-64288202 CCCTCCCTGACACTGTTCTTAGG + Intronic
956931624 3:74050050-74050072 CCCCCACAGGCACTGTGCAGTGG + Intergenic
959227528 3:103604024-103604046 CCCCCCCAGGCAGTTTGCTCAGG - Intergenic
961001639 3:123378205-123378227 CCCTCCCAGGGACTGGGATTTGG - Intronic
961440935 3:126952790-126952812 CCCGCTCAGGCACAGGGGTTGGG + Intronic
962935512 3:140076947-140076969 CCCGCCCAGGCACTGTGCTTTGG + Intronic
967219644 3:187237726-187237748 CCTTCCCAGGCAGGGTGCTTGGG + Intronic
968218497 3:196915184-196915206 CACGTCCTGGCACTGTGCTGGGG + Intronic
968289467 3:197527452-197527474 CCCACCAGGGCACTGGGCTTTGG + Intronic
969451455 4:7276293-7276315 CCTGCCCATGCCCTGTGCTGAGG + Intronic
976879305 4:89899384-89899406 CCAGCACAAGCACAGTGCTTGGG - Intronic
986402344 5:7394494-7394516 CCCGGCCTGGCCCTGTGCTCAGG + Intergenic
996404235 5:123090411-123090433 CCCCCCAAGGAACTGTGCCTCGG + Exonic
997193919 5:131965020-131965042 CTGGCCCAGGGACTCTGCTTAGG - Intronic
997929947 5:138064292-138064314 CCAGGCCAGGCACTGTGTTGAGG + Intergenic
1002644552 5:180646724-180646746 CCCGAACAGGCACTATGCTGGGG + Intronic
1007585503 6:42986578-42986600 CCCACCCAGGCCCTGTCCTTGGG + Intronic
1013006291 6:106077277-106077299 CACCACCAGGCACTGTGCTAAGG + Intergenic
1016847076 6:148579044-148579066 TCAGCCCAGGCTGTGTGCTTTGG + Intergenic
1016956069 6:149627876-149627898 CTCCCTCAGGCACTGTGCTGTGG - Intronic
1018173722 6:161161873-161161895 CACGCACAGGCACTCTGCCTAGG + Intronic
1019746082 7:2701046-2701068 CCATCCCAGGCACTGTGCTGCGG + Intronic
1021570739 7:22062474-22062496 CCCTCCCTGGCACAGTGCCTTGG - Intergenic
1023879361 7:44309522-44309544 CCTCCCCATGCCCTGTGCTTAGG - Intronic
1025865162 7:65374209-65374231 CCTGCGCAGTGACTGTGCTTTGG + Intronic
1026744075 7:72997691-72997713 CCCCCCCAGGCACTGTGCCAAGG + Intergenic
1026804323 7:73420312-73420334 CCCCACCAGGCACTGTGCCAAGG + Intergenic
1027030181 7:74882368-74882390 CCCCCCCAGGCACTGTGCCAAGG + Intergenic
1027099662 7:75367401-75367423 CCCCCCCAGGCACTGTGCCAAGG - Intergenic
1027870794 7:83704960-83704982 TCTGCCAAGGCACTCTGCTTGGG - Intergenic
1034393540 7:150803295-150803317 CCCGCCCAAGCTGTGTGCTGGGG + Intronic
1034560271 7:151875904-151875926 CCCGCCCCGGGAGTGTACTTTGG - Intronic
1035103676 7:156422739-156422761 GCCGCCCAGGGACTGAGCATAGG + Intergenic
1036699480 8:11002543-11002565 CCCGCCCAGCCACAGGGCTCTGG - Intronic
1037817206 8:22118566-22118588 CCAGCCCTGCCACTGAGCTTCGG + Intronic
1039755686 8:40519439-40519461 GCCACCCCGGCACTGTGCTCGGG + Intergenic
1041348292 8:56923833-56923855 TCAGCCCAAGCACTGTGCTGTGG + Intergenic
1041846990 8:62340564-62340586 CCTGCCAAAGCACTGTACTTTGG + Intronic
1043582669 8:81732408-81732430 CCCGCCCAGCCGCTGTGCAGCGG + Intronic
1046260191 8:111758311-111758333 CCAGCCCAGGCAGCCTGCTTGGG - Intergenic
1048465405 8:134661313-134661335 CCTGCCCAGTGACTGTGCTGGGG - Intronic
1048972631 8:139653852-139653874 CCCTCCCAGGAATTTTGCTTGGG + Intronic
1049698206 8:143993939-143993961 CCTGCCCAGGCCCGGTCCTTTGG + Intronic
1049879919 8:145054771-145054793 CCAGGCCAGGCTCTGTTCTTAGG + Exonic
1049896891 9:117418-117440 CCCGCCCAGGCCCTCTGCTTGGG - Exonic
1053195755 9:36117169-36117191 CCCTGCCAGGTACAGTGCTTTGG + Exonic
1053739994 9:41127670-41127692 CCCACCCAGGCCCTCTGCTTGGG - Exonic
1054442958 9:65283664-65283686 CCCACCCAGGCCCTCTGCTTGGG - Exonic
1054487322 9:65737837-65737859 CCCACCCAGGCCCTCTGCTTGGG + Exonic
1054688356 9:68303643-68303665 CCCGCCCAGGCCCTCTGCTTGGG + Exonic
1056038224 9:82632176-82632198 CTCTCCCATGCACTGGGCTTAGG - Intergenic
1058881027 9:109286079-109286101 GCCAGCCAGGCACTGTGCTTTGG - Intronic
1060154809 9:121312269-121312291 CCCGCCCAGCGACAGGGCTTGGG - Intronic
1060483839 9:124034562-124034584 CGCGCGCACGCAATGTGCTTGGG - Intergenic
1060789919 9:126478994-126479016 CACGCCCAGGTACTGTGCACAGG - Intronic
1060790679 9:126483541-126483563 GCCGCCCAGCCACTGTGTCTGGG - Intronic
1061138793 9:128751980-128752002 CCCCCCATGGCACTGTGCTCTGG + Intronic
1062000932 9:134215329-134215351 CCCACTCAGGCCCTGTGCTGGGG + Intergenic
1062057428 9:134475761-134475783 CCCACACAGGCTCTGGGCTTTGG - Intergenic
1062518517 9:136947724-136947746 CCCACCCAGGCCGTGTGCTTTGG - Intronic
1062594555 9:137293192-137293214 CCCTCCCAGGCACTGAGCCCAGG - Intergenic
1187181715 X:16948751-16948773 CACGCACAGCCACTGTGCCTTGG - Intronic
1190322487 X:49187083-49187105 CCCGCCCTGGAACTGAGCTGGGG - Intergenic
1199980243 X:152916769-152916791 CCCTCCCATCCTCTGTGCTTGGG - Intronic