ID: 962935957

View in Genome Browser
Species Human (GRCh38)
Location 3:140080989-140081011
Sequence GTGGAGTGAAGGATATTCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 181}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962935957_962935961 27 Left 962935957 3:140080989-140081011 CCTCTGAATATCCTTCACTCCAC 0: 1
1: 0
2: 0
3: 14
4: 181
Right 962935961 3:140081039-140081061 ACACCGATGCTATGTCTTTGTGG 0: 1
1: 0
2: 0
3: 6
4: 68

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962935957 Original CRISPR GTGGAGTGAAGGATATTCAG AGG (reversed) Intronic
902986600 1:20158252-20158274 GAGGTGTGCAGGATATGCAGTGG + Intergenic
903844753 1:26272289-26272311 GGGGAGTGCAGGAGAGTCAGTGG + Intronic
904313196 1:29642527-29642549 GTGGAGTGTCTGATGTTCAGGGG + Intergenic
909817070 1:80008708-80008730 GTGGATTGGACGATATTCAAGGG + Intergenic
910192029 1:84604550-84604572 GTGGAGAGAGGGATGTTCATTGG - Intergenic
910224798 1:84925448-84925470 AAGCAGTGAAGGATATACAGGGG - Intergenic
913428165 1:118758160-118758182 GTGGAGTGAAGGAGAGTCCAGGG - Intergenic
917226659 1:172790802-172790824 GAGGAGGGAAGGAGGTTCAGAGG + Intergenic
917670456 1:177269045-177269067 TTGGAGTGAAGACTATTCACTGG - Intronic
918836991 1:189479158-189479180 GTGCAGTGTCTGATATTCAGAGG + Intergenic
919896991 1:202015182-202015204 GTGAAGAGAAGGATGGTCAGAGG - Intronic
919924850 1:202186917-202186939 GTGGAGGGAAGGTTTCTCAGTGG + Intergenic
1063773513 10:9232274-9232296 GTGGAGTGTGGCATATTCATAGG + Intergenic
1065569446 10:27054961-27054983 GTGGAGAGAATGAATTTCAGGGG + Intronic
1066498473 10:35966006-35966028 GTGGAGTAAAAAATATTGAGAGG + Intergenic
1068629419 10:59284501-59284523 GTGGGGGAAAGGATATGCAGAGG - Intronic
1068757798 10:60673826-60673848 GGGGAAGGAAGAATATTCAGAGG + Intronic
1068795419 10:61074046-61074068 ATGTGGTGAAGGAGATTCAGAGG + Intergenic
1072181205 10:92982286-92982308 TTAGAGTAAAAGATATTCAGAGG - Intronic
1072860539 10:98999608-98999630 GGGAATTGAAGGATATTCTGTGG + Intronic
1073291538 10:102415775-102415797 GGGGACAGAAGGATATTGAGGGG - Intronic
1077302696 11:1854602-1854624 GTGGAGTGGAGGCTAAGCAGAGG + Intronic
1077808167 11:5610240-5610262 GTAGAGGTAAGGAGATTCAGGGG + Exonic
1088290371 11:108230611-108230633 TTAAAGTGAAGAATATTCAGAGG - Intronic
1088537157 11:110873773-110873795 TTGGAGAGAAGGAAATTCATGGG - Intergenic
1090540509 11:127698192-127698214 GAGGAGTGAAGGAGATTCTCAGG - Intergenic
1091116769 11:133020395-133020417 GTTGGGTTAAAGATATTCAGAGG - Intronic
1093174657 12:15899442-15899464 GTGGACTGTAGGAAATTAAGAGG + Intronic
1095332825 12:40989501-40989523 ATGGAGTGATGGATATTATGTGG + Intronic
1103899659 12:124296620-124296642 GTGGGGAGGAGGATTTTCAGCGG - Intronic
1103952531 12:124558805-124558827 GTGAAGTGAAGGGCATTCAGGGG - Intronic
1104272654 12:127295888-127295910 GTGGGGTGAAGAATAATGAGAGG + Intergenic
1105213449 13:18271271-18271293 GTGGGGTGGAGGGTCTTCAGAGG - Intergenic
1106128746 13:26922211-26922233 TTGGAGGGAAGGATTTTCAGGGG + Intergenic
1108346799 13:49554377-49554399 CTGGAATGGAGGATATTCAACGG + Intronic
1108966698 13:56315368-56315390 GTAGAGTTAATGATCTTCAGAGG + Intergenic
1111155964 13:84326488-84326510 GTGCACTGAAGGATATTTAAAGG - Intergenic
1111257273 13:85686852-85686874 ATGTAGTTAAGGATCTTCAGAGG + Intergenic
1113602761 13:111582392-111582414 GTGGAGTGAATGGTATTTCGTGG + Intergenic
1114062540 14:19032161-19032183 CTGGAGTCAAGGTTATCCAGTGG - Intergenic
1114099721 14:19367836-19367858 CTGGAGTCAAGGTTATCCAGTGG + Intergenic
1115910686 14:38254418-38254440 GTGGAGTAAAGGGAATTTAGAGG + Exonic
1116287427 14:42990537-42990559 GTGGAGTTAAGGTTATTTTGTGG + Intergenic
1116508698 14:45717093-45717115 CTTGAGTGAGGGAAATTCAGTGG + Intergenic
1116629132 14:47306700-47306722 GTGGAGAGAAGGATGTTCACTGG + Intronic
1120313428 14:82860755-82860777 GTGGGGTGCAGGATATTATGTGG - Intergenic
1121109903 14:91305323-91305345 GGGAAGTGTAGGATATTAAGTGG - Intronic
1121555438 14:94832981-94833003 GTGGGGTGCAGGATATTGACTGG + Intergenic
1123584091 15:21741871-21741893 TTGGAGTGAGGGATTTTAAGAGG - Intergenic
1123620741 15:22184474-22184496 TTGGAGTGAGGGATTTTAAGAGG - Intergenic
1127060060 15:55173162-55173184 GTGCATTGCAGGATGTTCAGCGG + Intergenic
1127263905 15:57346132-57346154 TTGGAGTGAAGGAGAAGCAGAGG - Intergenic
1127598143 15:60507798-60507820 GTGGAGTGAAGGATGAGAAGAGG + Intronic
1128535577 15:68487420-68487442 GTGGAGAGAAGGCCATTCTGAGG - Intergenic
1129293054 15:74583363-74583385 GTGGAGGGATGGATATTGATTGG + Intronic
1129644959 15:77420908-77420930 GTGAAGTGAAGGCGATTGAGAGG + Exonic
1133568011 16:7013485-7013507 GTGTAATGCAGGATATTTAGAGG - Intronic
1134603604 16:15552499-15552521 AAGGAGTGAAGGATGTGCAGAGG + Intronic
1134816285 16:17208315-17208337 GAGAAGTGCAGGATGTTCAGAGG - Intronic
1135181760 16:20281047-20281069 GAGGAGAGAAGGAAATTGAGAGG - Intergenic
1138790674 16:59900216-59900238 GTGGTGTGCAGGACATTTAGCGG + Intergenic
1141743033 16:85906856-85906878 GTGGATTGTAGAATATTCAGCGG - Intronic
1141836467 16:86543425-86543447 TTGGAGTGAAGTATGTTCTGTGG - Intronic
1152603291 17:81276250-81276272 GTGGATTGAAGGCCATTCTGGGG - Intronic
1154451788 18:14483761-14483783 TTGGAGTCAAGGTTCTTCAGTGG + Intergenic
1155869234 18:31005334-31005356 GTTGAGTGAAGAAAAATCAGAGG - Intronic
1155916281 18:31560657-31560679 GTGAGGTGAAGGGCATTCAGCGG - Intergenic
1157038013 18:44000154-44000176 GTGGAGTATAGGATCTTCAAGGG - Intergenic
1157625672 18:49048808-49048830 GTGGTGGGAAGGATAGTCATGGG - Intronic
1158388408 18:57021143-57021165 GTGGTGGGAAGGCTTTTCAGGGG + Intronic
1158844155 18:61423507-61423529 TTGTAGTGTAGCATATTCAGGGG - Intronic
1161057537 19:2198245-2198267 GGGGAATGAGGGATGTTCAGAGG + Intronic
1163555485 19:17989983-17990005 GTGGATGGGAGGATCTTCAGAGG + Intronic
1164532431 19:29058590-29058612 GAGGCCTGGAGGATATTCAGTGG + Intergenic
1164535769 19:29085414-29085436 GAGGAGAGAAGGACAGTCAGAGG + Intergenic
1164895124 19:31870088-31870110 GTGCAGAGAAGGATATTCTCTGG + Intergenic
1167241535 19:48346443-48346465 GTGGATTCAAGAAGATTCAGGGG - Intronic
1167991633 19:53365734-53365756 GTGGAGTGAAGGTCCCTCAGCGG + Exonic
926211165 2:10870600-10870622 ATGTGGTGAAGGATATTGAGAGG + Intergenic
926584657 2:14672803-14672825 TTGGAGTAAAGTATATTCACTGG + Intergenic
926854238 2:17235207-17235229 TTGGAGTGAAGAATAGACAGGGG - Intergenic
927264750 2:21132918-21132940 GTGCATTATAGGATATTCAGCGG + Intronic
930518526 2:52435320-52435342 GAGGTGTGCAGGATATGCAGTGG + Intergenic
931911039 2:66900409-66900431 AGGGAGAGAAGGAAATTCAGTGG + Intergenic
932972241 2:76558377-76558399 GTGGCATGAAGGATATTTAGAGG - Intergenic
936891615 2:117377235-117377257 ATAGTGTGAAGGAAATTCAGTGG - Intergenic
938753496 2:134358166-134358188 GTGGAGTGATGGATAGAGAGAGG - Intronic
940048182 2:149432516-149432538 GTGGAGTGAAGCTTGATCAGTGG + Intronic
940228091 2:151421461-151421483 GTGGAGTGAATGAGAGTGAGAGG + Intronic
941305022 2:163853805-163853827 CTGGAGTTAAGGACATGCAGAGG - Intergenic
941402696 2:165049815-165049837 GTGGAGTGAAATAAATTCAAGGG + Intergenic
941549557 2:166897941-166897963 GTGGCATGCAGGATACTCAGGGG + Intronic
942190820 2:173468210-173468232 GAGGATAGAAGGATATTCTGCGG + Intergenic
943070895 2:183139500-183139522 ATTGAGTTAAGGATTTTCAGAGG + Intronic
947504544 2:230697307-230697329 GTGAACTGTAGGATATTGAGGGG - Intergenic
948063380 2:235058615-235058637 GTGGGGTGATGGATACTCAGAGG - Intergenic
948525987 2:238571113-238571135 GTGGAGTCAAGAAAAATCAGGGG - Intergenic
1170404000 20:16017431-16017453 GTGTTGTGAAGGATATTTTGAGG + Intronic
1171976957 20:31601301-31601323 GTGGATAGAAGGATATGCATAGG + Intergenic
1172819529 20:37719064-37719086 GTGGCATCAAGGATATTCAGAGG - Intronic
1176444355 21:6806459-6806481 TTGGAGTCAAGGTTCTTCAGTGG - Intergenic
1176822520 21:13671497-13671519 TTGGAGTCAAGGTTCTTCAGTGG - Intergenic
1178751463 21:35308210-35308232 GAGGAGCTATGGATATTCAGTGG - Intronic
1180049404 21:45324445-45324467 GTGGGGTGAAGGATGTGGAGGGG + Intergenic
1180481032 22:15754788-15754810 CTGGAGTCAAGGTTATCCAGTGG - Intergenic
1180816281 22:18791671-18791693 GTGGGGTGGAGGGTCTTCAGAGG - Intergenic
1181202470 22:21226003-21226025 GTGGGGTGGAGGGTCTTCAGAGG - Intronic
1181699237 22:24610611-24610633 GTGGGGTGGAGGGTCTTCAGAGG + Intronic
1182050982 22:27312334-27312356 GTGGAGAGAGGGAGATTGAGAGG + Intergenic
1183320136 22:37160276-37160298 CTGGAGTGTATGAGATTCAGCGG + Intronic
1184354468 22:43969700-43969722 GTGGGGTGAAGAATGTTCTGGGG + Intronic
1184600383 22:45539797-45539819 GTGGAGTGCACGATGTTCTGAGG + Intronic
1203224443 22_KI270731v1_random:69410-69432 GTGGGGTGGAGGGTCTTCAGAGG + Intergenic
1203266384 22_KI270734v1_random:17382-17404 GTGGGGTGGAGGGTCTTCAGAGG - Intergenic
949334087 3:2954502-2954524 GTGGACTGAATGAAATTCAAAGG - Intronic
955044922 3:55350709-55350731 GTGGAGTGGAGGATGTTAGGAGG - Intergenic
955725585 3:61929004-61929026 GTGCATTGTAGGATGTTCAGTGG - Intronic
956206502 3:66760395-66760417 GTGGATTGTAAGATTTTCAGTGG - Intergenic
956742729 3:72287696-72287718 ATGGAATCAAGAATATTCAGGGG + Intergenic
958127403 3:89374919-89374941 GTGGAATGAAGGATAGTTTGTGG - Intronic
960030932 3:113054251-113054273 GTGCATTGTAGGATATTTAGTGG + Intergenic
962876755 3:139541182-139541204 GTGTACTGTAGGATATTTAGTGG + Intergenic
962894791 3:139704542-139704564 CTGGAATCAAGGATGTTCAGAGG + Intergenic
962935957 3:140080989-140081011 GTGGAGTGAAGGATATTCAGAGG - Intronic
963868835 3:150391696-150391718 GTGGAGAGAAATATATTGAGAGG - Intergenic
964835229 3:160930671-160930693 GCGGAGTGAAGGAGTTTAAGAGG + Intronic
966024245 3:175256535-175256557 GTCCAGTGAATGTTATTCAGTGG + Intronic
966993554 3:185257983-185258005 GTGGACTTAAGGATATTGAATGG - Intronic
969855061 4:9992389-9992411 GTGCATTGTAGGATATTTAGAGG + Intronic
970903531 4:21188247-21188269 CTGGAGTGAAGGATAAACACAGG + Intronic
972753976 4:42025135-42025157 GTAGAGTGAAGGTTAGTGAGAGG - Intronic
973337663 4:48972600-48972622 GTGGAGTGAAGTTTCTTCTGGGG + Intergenic
974882177 4:67773479-67773501 GTGCATTGGAGGATATTTAGTGG - Intergenic
976214776 4:82705631-82705653 CTGTAGGGAAGGATATTCAAAGG - Intronic
982041310 4:151399613-151399635 GTGGAGTTAGTGATTTTCAGGGG + Intergenic
986896471 5:12376738-12376760 GTGGAGCTAAGCATAATCAGGGG + Intergenic
989650043 5:43677855-43677877 GTGGAGAAAAGGAAATACAGTGG + Intronic
990285008 5:54292409-54292431 GTGGAGGGCAGGAGTTTCAGTGG - Intronic
990731285 5:58811843-58811865 GAGGAGTGAAGGCTGGTCAGGGG - Intronic
992259066 5:74952038-74952060 GTGTGGTGAAGGTTACTCAGTGG - Intergenic
994105571 5:95944939-95944961 GAGGACTGATGGATATCCAGTGG - Intronic
996997418 5:129714569-129714591 GTGGAGTGAGGGATATCAGGGGG + Intronic
998033447 5:138893132-138893154 CTTGAGTGAAGGGCATTCAGAGG - Intronic
998527230 5:142853714-142853736 GTGGAGTCAAGGCTACTCTGAGG - Intronic
998975838 5:147645738-147645760 GTGCAGTGGAGGATGTTTAGCGG + Intronic
999476091 5:151900081-151900103 GTGGATGGAAGGCTATCCAGAGG - Intronic
999629998 5:153561072-153561094 TTGGAGTAAAGGATTCTCAGTGG + Intronic
1002088191 5:176788945-176788967 GTGGGGGGAATGATCTTCAGAGG + Intergenic
1005507775 6:26484893-26484915 GAGGAGTGAAATATATACAGAGG + Intergenic
1006801858 6:36764896-36764918 GTGGGGTGACGGAGATGCAGAGG - Intronic
1007335196 6:41150633-41150655 GGGGAGGGAAGGAGATTCAATGG - Intronic
1007820288 6:44555847-44555869 GTGGAGTGAGGGATGCTCAGGGG + Intergenic
1010160814 6:72852616-72852638 GTGGAGAGAAGGAGATGAAGGGG + Intronic
1015628870 6:135210727-135210749 GATGAGTGAAGGATATTCCATGG - Intronic
1016081276 6:139860592-139860614 GTGGAGAGGAAGATATTAAGAGG + Intergenic
1016934852 6:149441939-149441961 GGGGAGTGAAGGATCTTGGGAGG - Intergenic
1018095461 6:160383892-160383914 GTGTATGGAAGGATATTCATAGG + Intronic
1020530527 7:9328536-9328558 GTGGAGTTAAGGCTATTTGGGGG - Intergenic
1024527062 7:50357709-50357731 GTGTAGTGTGGGCTATTCAGAGG + Intronic
1026233169 7:68503171-68503193 GTGGAGTAAATAATATTCAGAGG - Intergenic
1026365129 7:69640706-69640728 GTGGAATGAACAATATTCTGAGG - Intronic
1027723345 7:81771476-81771498 GTGGAGGGAAGGCTGTTCTGTGG - Intergenic
1028085613 7:86633480-86633502 GTGGACAAAAGGACATTCAGGGG + Intergenic
1028234361 7:88342765-88342787 GTGGAGAGAATGATACTCGGAGG - Intergenic
1028294565 7:89112385-89112407 AAGGAGCAAAGGATATTCAGTGG - Intronic
1029606415 7:101601878-101601900 GGGGAGGGCGGGATATTCAGGGG - Intergenic
1032408371 7:131674280-131674302 GGGGAGTGAATGATAGGCAGGGG + Intergenic
1032443711 7:131962130-131962152 GTGGAGGGACGGATGCTCAGTGG - Intergenic
1037749373 8:21670533-21670555 GTGGATCGAAGGGTATTCTGTGG - Intergenic
1038267718 8:26049196-26049218 GCATAGTGAAGGAGATTCAGCGG + Intergenic
1038296340 8:26293672-26293694 GAGGAGGGAATGATATTCAGTGG + Exonic
1038369129 8:26970094-26970116 GTGGAATGAACTAAATTCAGTGG + Intergenic
1038849131 8:31257136-31257158 GTGGAGAGAAGAATGTGCAGTGG + Intergenic
1039614280 8:38942548-38942570 ATGGAGAGAATGGTATTCAGGGG + Intronic
1047593450 8:126351707-126351729 ACAGAGTGAAGTATATTCAGGGG + Intergenic
1054874801 9:70084542-70084564 GTGGAGTAAAGGTTAGGCAGGGG - Intronic
1055312979 9:75003580-75003602 CTGCTGTGAAGGAGATTCAGGGG - Intronic
1055389978 9:75809921-75809943 ATGGAGGAAAGGATTTTCAGAGG - Intergenic
1056053185 9:82791453-82791475 GTGGTGTGAAGAATGATCAGGGG - Intergenic
1057075480 9:92136119-92136141 GTGGAGGGAAGGTTTCTCAGTGG + Intergenic
1060417300 9:123440494-123440516 GTAGGGAGAAGGATAGTCAGCGG + Intronic
1062691249 9:137842714-137842736 GTGGCGTGGAGGATATGGAGGGG - Intronic
1203524843 Un_GL000213v1:78068-78090 TTGGAGTCAAGGTTCTTCAGTGG + Intergenic
1186393680 X:9186216-9186238 GTAGAGTGAAACATATTCTGTGG - Intergenic
1186801742 X:13099613-13099635 GTGTAATGAATGATTTTCAGGGG + Intergenic
1187058735 X:15765622-15765644 GGGGAGTGAGGGATATGGAGGGG - Intronic
1188101599 X:26094728-26094750 TTGGAGTGAGGGAGAATCAGAGG + Intergenic
1189050376 X:37638773-37638795 GTGGGGTGAATGATATTCATTGG - Intronic
1194089614 X:89568485-89568507 TAGGAGTAAATGATATTCAGAGG + Intergenic
1195200300 X:102543410-102543432 ATGGAGTGAAGCATCTTCAGAGG - Intergenic
1195343621 X:103927296-103927318 GTGCATTGGAGGATATTCAGAGG - Intronic
1197318474 X:124997870-124997892 GTGGTGTAAAGAATAGTCAGAGG - Intergenic
1199084645 X:143614957-143614979 GTGGGGTGAAGGATATAGAGGGG + Intergenic
1199326061 X:146499806-146499828 GAGCAGTGTAGGATAGTCAGGGG - Intergenic
1199652263 X:149957942-149957964 CTGGCATGAAGGATCTTCAGAGG - Intergenic
1200442269 Y:3224538-3224560 TAGGAGTAAATGATATTCAGAGG + Intergenic