ID: 962936665

View in Genome Browser
Species Human (GRCh38)
Location 3:140087786-140087808
Sequence GAGGTGAATTTTGAGTTAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 217
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 199}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962936660_962936665 22 Left 962936660 3:140087741-140087763 CCCAACCTGAGAGAGGAGAGTAA 0: 1
1: 0
2: 2
3: 14
4: 185
Right 962936665 3:140087786-140087808 GAGGTGAATTTTGAGTTAAGTGG 0: 1
1: 0
2: 1
3: 16
4: 199
962936659_962936665 27 Left 962936659 3:140087736-140087758 CCTAACCCAACCTGAGAGAGGAG 0: 1
1: 0
2: 3
3: 14
4: 212
Right 962936665 3:140087786-140087808 GAGGTGAATTTTGAGTTAAGTGG 0: 1
1: 0
2: 1
3: 16
4: 199
962936661_962936665 21 Left 962936661 3:140087742-140087764 CCAACCTGAGAGAGGAGAGTAAT 0: 1
1: 0
2: 0
3: 10
4: 180
Right 962936665 3:140087786-140087808 GAGGTGAATTTTGAGTTAAGTGG 0: 1
1: 0
2: 1
3: 16
4: 199
962936662_962936665 17 Left 962936662 3:140087746-140087768 CCTGAGAGAGGAGAGTAATATCA 0: 1
1: 0
2: 4
3: 10
4: 199
Right 962936665 3:140087786-140087808 GAGGTGAATTTTGAGTTAAGTGG 0: 1
1: 0
2: 1
3: 16
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962936665 Original CRISPR GAGGTGAATTTTGAGTTAAG TGG Intronic
903147029 1:21380772-21380794 GATGTGAATTTTGAGTTCTCAGG + Intergenic
904838596 1:33355510-33355532 GAGGTGAGTTTTTAGTTTTGAGG - Intronic
906093236 1:43200620-43200642 CAGATGAATTTGGAGATAAGAGG + Intronic
906318314 1:44801930-44801952 GAAGTGAGTTTTGAGGAAAGGGG + Exonic
907178766 1:52552585-52552607 GGGGCGGATTTTGAGTTAACGGG - Intronic
908751275 1:67426134-67426156 GAGGCGAATTTTCAGTTGATAGG - Exonic
909007987 1:70299758-70299780 AAGGTGAATTTTGAGGTACCTGG + Intronic
909319747 1:74269120-74269142 GAGGTGACTTTTGAGATAAATGG - Intronic
911533662 1:99075768-99075790 GAGGTAATATTTGAGTTGAGAGG - Intergenic
911551109 1:99282074-99282096 GAGGTCAATTTGGAGCTAACAGG - Intronic
914325094 1:146605609-146605631 AAGGAGAAATTTGAGATAAGAGG - Intergenic
915665837 1:157444046-157444068 AAGGTGAATTTTCACTTATGTGG - Intergenic
915741159 1:158119273-158119295 GAGGAGCATTTTGGGTTAGGGGG + Intergenic
915930825 1:160059891-160059913 CAGGTAAATTTTGACTTAACTGG - Intronic
916879323 1:169004125-169004147 GAGGAGGATTTTGAGGTGAGAGG + Intergenic
916910865 1:169344527-169344549 GAAGTGAACTTTGAACTAAGGGG - Intronic
918519803 1:185403589-185403611 GAGATGAATCTGGAGTTTAGGGG + Intergenic
918675028 1:187273329-187273351 ATGGTGAATGTTGACTTAAGGGG + Intergenic
919040515 1:192382024-192382046 AGGGTGAATTTTGAGCTAAGAGG + Intergenic
919472726 1:197999098-197999120 GGTCTGAATTTTGAATTAAGGGG - Intergenic
919596193 1:199565693-199565715 TAGGTTAATTTTGAGAAAAGTGG - Intergenic
920183856 1:204148728-204148750 CAGGTGCATTTGGGGTTAAGTGG + Intronic
922627635 1:227065588-227065610 CATTTGAATTTTGAGTTAACAGG + Intronic
922931178 1:229390923-229390945 GAAGTGAATTTGGAGCTGAGGGG + Intergenic
924427761 1:243968994-243969016 GAAGTGAATTTTAATTTAAGAGG - Intergenic
1065010619 10:21417486-21417508 GTGCTTAATTTTGTGTTAAGTGG - Intergenic
1065939457 10:30551043-30551065 GAGGAGATGTTTGAGTTAAGTGG + Intergenic
1068200868 10:53782783-53782805 AAGATAAATTTGGAGTTAAGAGG - Intergenic
1070046345 10:72841057-72841079 GAAGTGAATTTTGAGGGAATTGG + Intronic
1072340190 10:94439764-94439786 AAGGTGAATTTGGAGTTAAGAGG + Intronic
1072845718 10:98828037-98828059 GAGTTGAAGTTTGAGTTCAAAGG - Intronic
1073755985 10:106580934-106580956 GAGGTGAAGTTTGACTTACAGGG - Intronic
1074124184 10:110515190-110515212 AAGGTGAATTTTGAACTGAGAGG - Intergenic
1075501758 10:122980818-122980840 GAGGTGAAGTTCGAGAAAAGTGG + Intronic
1079607922 11:22392857-22392879 GAATTGAATTCTGAGGTAAGGGG + Intergenic
1081163272 11:39777622-39777644 GAAGTGGATTTTGACTTGAGAGG - Intergenic
1082818034 11:57523405-57523427 GTGGTGAGTTCTGTGTTAAGTGG - Intergenic
1087250718 11:95896146-95896168 GAGGTGATATTTCAGTTGAGAGG - Intronic
1087832428 11:102833562-102833584 GAGGTGAATTTTGCCTTTAAAGG + Intergenic
1088062918 11:105679262-105679284 AAGGTGGATTCTGAGTAAAGGGG - Intronic
1090502817 11:127278352-127278374 GTGGTGAGTTTTGTTTTAAGAGG + Intergenic
1090574721 11:128088491-128088513 GAGATGAATTTTGAATTATAAGG + Intergenic
1092276396 12:7064390-7064412 GAGGTGAGCTTGGTGTTAAGAGG + Exonic
1092730746 12:11532017-11532039 GTGGTCAATTTTGAAATAAGTGG + Intergenic
1094385637 12:29890022-29890044 AAGGTGAATTTGGAGCTGAGAGG + Intergenic
1095619685 12:44236868-44236890 CAGGTGAACTTTGAATAAAGTGG - Intronic
1096784567 12:54009665-54009687 GAGACGAGTTTTGATTTAAGTGG - Exonic
1096862647 12:54540970-54540992 GAGCTGTATTCTGAGTTAAGAGG + Intronic
1097610801 12:61817601-61817623 GAGGTTCTTTTTGTGTTAAGTGG + Intronic
1098921473 12:76306092-76306114 GAGGTGGATTGAGAGTTTAGTGG + Intergenic
1098934985 12:76468351-76468373 TAAGTGGAGTTTGAGTTAAGTGG - Intronic
1099924225 12:88997799-88997821 GAGTTGAATTTTGAGGCAAGGGG + Intergenic
1100158411 12:91829087-91829109 GAAGAGAATTTTGAGAGAAGTGG + Intergenic
1100505679 12:95217872-95217894 GAGGTGGTTTTTGAGGTAAGAGG + Exonic
1100582674 12:95949974-95949996 GAGGTGAATTTTGAGGGCACTGG - Intronic
1100915244 12:99413256-99413278 GAGCTGAAATTAAAGTTAAGTGG + Intronic
1103643686 12:122373639-122373661 GAAATGAAATTTGAGTCAAGGGG - Intronic
1109411337 13:61973281-61973303 AAAGTGAATTTTGAGAGAAGAGG + Intergenic
1111960244 13:94802171-94802193 CATGTGAATTGTGAGTTAACGGG + Intergenic
1115034168 14:28837430-28837452 AGGGTGAATTTTGAGCTGAGAGG - Intergenic
1116762391 14:49030801-49030823 TAGGAGAATCTTGAGTCAAGAGG + Intergenic
1118041683 14:61923711-61923733 GAAATGAATTTTGAGTTTAGGGG + Intergenic
1120012606 14:79434666-79434688 GAGGTGAAGATTGAGTGCAGGGG + Intronic
1121806288 14:96827218-96827240 GGGGTGAATTTGGAGTTGAGAGG - Intronic
1123137183 14:106038797-106038819 GAGGTGGATGTAGAGTTAATTGG - Intergenic
1125120701 15:36155499-36155521 GAGGTGAATTCTGAGTTTTATGG + Intergenic
1126102206 15:45125655-45125677 GAGGTAAAGTTTGAGGAAAGGGG - Intronic
1126510032 15:49460344-49460366 AAGGTGAAGTTTGATTTTAGTGG + Intronic
1128962339 15:72020354-72020376 GGGATGAATTTTGAGTTTTGAGG + Intronic
1129609614 15:77042910-77042932 CAGGGAAATTTGGAGTTAAGAGG - Exonic
1131742693 15:95411379-95411401 GAGGTTAACCTTGAGATAAGAGG - Intergenic
1132984849 16:2760006-2760028 GAGGTGAGTTGTGAATGAAGCGG + Intronic
1133679761 16:8109917-8109939 GAGGTGATATATGAGTTAAGAGG - Intergenic
1135659606 16:24283955-24283977 GATGGGAATTCTTAGTTAAGTGG - Intronic
1136606211 16:31335704-31335726 GAGGTGAACTCTGAGTTCACAGG - Intergenic
1136990142 16:35147055-35147077 GATGTGAATGTTGAGTCATGAGG + Intergenic
1137806099 16:51306989-51307011 GAGTTGAAGTTTGAGTCCAGGGG + Intergenic
1140008470 16:71105337-71105359 AAGGAGAAATTTGAGATAAGAGG + Intronic
1140665444 16:77223225-77223247 AAGGTGAATTTGGAGCTGAGAGG - Intergenic
1142219590 16:88847396-88847418 GGGGTGAATTTGGAGAAAAGTGG - Intronic
1143692422 17:8580360-8580382 AGGTAGAATTTTGAGTTAAGTGG + Intronic
1144449134 17:15360700-15360722 AAAGTAAATTTTGAGTTAATGGG + Intergenic
1148212977 17:45819419-45819441 GGGGTGGTTCTTGAGTTAAGAGG - Intronic
1149233457 17:54563797-54563819 CAGGTGATGTTTGAGTGAAGAGG + Intergenic
1151643631 17:75414662-75414684 GAGGTGGCTCCTGAGTTAAGTGG - Intergenic
1153159740 18:2190395-2190417 GAAGTGAAGTTTCAGTTAAATGG - Intergenic
1153684428 18:7531111-7531133 CAAGTAAATTTTGAGTTAAATGG + Intergenic
1156317089 18:35980034-35980056 GAGGGGAAATTTCAATTAAGAGG + Intergenic
1156362886 18:36399858-36399880 GAGGACAGTTTTGAGTTTAGAGG + Intronic
1157415436 18:47498458-47498480 GTGGTGAAATTTGATTTTAGTGG + Intergenic
1159140469 18:64388450-64388472 GAGGAGAATTTTGATGTAGGAGG - Intergenic
1160237133 18:77094644-77094666 AAAGTTAATTTTGAGTTCAGAGG - Intronic
1162993570 19:14319224-14319246 CAGGTGAAAGATGAGTTAAGTGG + Intergenic
1164388277 19:27794943-27794965 GATGTGAATTTTGAGACATGAGG + Intergenic
1165164541 19:33842311-33842333 GAGGGGCATTTAGAGTTAGGTGG + Intergenic
1168212684 19:54902051-54902073 GTGGTGAAATTTGAATAAAGTGG + Intergenic
925229361 2:2219064-2219086 GGGAGGAATTTTGAGTCAAGAGG + Intronic
926520911 2:13911864-13911886 GAGGTAAATGATGAGTTAATGGG + Intergenic
926657024 2:15419256-15419278 GATGAGAAATTTGAGTAAAGAGG + Intronic
929212358 2:39371221-39371243 GAGGTGAAATTTAAATGAAGTGG + Intronic
931133614 2:59370279-59370301 GATGTGAATTTTGAGAACAGAGG - Intergenic
931806137 2:65807301-65807323 GAGTTGAATTTTGAGGCAATGGG + Intergenic
933285823 2:80383607-80383629 TAGGTGAATTGTGAGTTAGAAGG + Intronic
933828551 2:86187048-86187070 ATGGTGAATTTTATGTTAAGGGG - Intronic
937328268 2:121005242-121005264 GAGGTGAAGTGTGAGTCACGTGG - Intergenic
937825221 2:126361556-126361578 GAGTGGAATTTGGAGATAAGAGG - Intergenic
938625235 2:133101804-133101826 GTGGTGTATGTTGAGCTAAGTGG + Intronic
939169004 2:138672302-138672324 GAGGTATATTTTGAATTAATAGG + Intronic
939877256 2:147592086-147592108 AGGGTGAATTTTGAGCTAAGAGG - Intergenic
942379093 2:175369068-175369090 GAAGTGCACTTTGAGTTAAAGGG + Intergenic
943207290 2:184917200-184917222 GAGATTAATTTTGGGTTAAAGGG - Intronic
944202314 2:197120768-197120790 GAGGTGAATGTTGAGCTGATAGG - Intronic
944517096 2:200523204-200523226 GAAGTGCATTTTGAGCTAGGCGG - Intronic
944539128 2:200740067-200740089 GAGGAGAATCTTGAGTTCAATGG + Intergenic
945779363 2:214149245-214149267 GAGGTGAATTTTGATTCATCAGG + Exonic
1168849095 20:964369-964391 GAGGTGATGTATGAGTTAAAGGG + Intronic
1170577399 20:17674802-17674824 GAGGTAGATTTTGTGTTTAGTGG - Intronic
1173274912 20:41572099-41572121 AGGGTGAGTTTGGAGTTAAGAGG - Intronic
1177550435 21:22614026-22614048 GATGTTCATTTTGAGTTCAGGGG - Intergenic
1177867047 21:26524956-26524978 AGGGTGAATTTGGAGCTAAGAGG + Intronic
1178371934 21:32033550-32033572 AAGGTGATTTTTCAGTAAAGAGG - Intronic
1182930066 22:34165090-34165112 GAGCTGAAATTTGAATTTAGAGG + Intergenic
1184446876 22:44553033-44553055 GATGTGAAATTTGAGTGACGTGG + Intergenic
950359979 3:12443317-12443339 GAGGTGACATTTGAGATGAGTGG + Intergenic
950503544 3:13378978-13379000 TACCTGAATTTTGAATTAAGGGG + Exonic
952183608 3:30944978-30945000 GGGGTGAATTTGGAGCTGAGAGG - Intergenic
953698265 3:45176790-45176812 GAGCTGCATTTGGAGGTAAGGGG - Intergenic
954336198 3:49919305-49919327 GTGGGGAATGTAGAGTTAAGGGG - Intronic
954991220 3:54842388-54842410 TAGGTAACATTTGAGTTAAGTGG + Intronic
955974463 3:64467080-64467102 GAGGAGACTTTTGGCTTAAGAGG + Intergenic
956152422 3:66257741-66257763 GAGATGGATTCAGAGTTAAGAGG - Intronic
957451742 3:80389125-80389147 GAGGTGAGTTTTTATTAAAGAGG - Intergenic
959556535 3:107725855-107725877 GAGGTGAATTTTCATTTAATGGG + Intronic
959775323 3:110152879-110152901 GAGATGAAATTAGAGTTAGGTGG - Intergenic
959867237 3:111284822-111284844 GAGATGAATTTTGGGACAAGTGG - Intergenic
960748158 3:120912998-120913020 GAGGTGATGTTTGAATTATGAGG - Intronic
961076685 3:123989378-123989400 AAGGTGAATTTGGAGCTGAGAGG - Intronic
962936665 3:140087786-140087808 GAGGTGAATTTTGAGTTAAGTGG + Intronic
962973251 3:140424505-140424527 AAGGTGAACTTCCAGTTAAGAGG - Intronic
963453303 3:145513019-145513041 CTGGAGAATTTTGAGATAAGAGG + Intergenic
963866054 3:150362906-150362928 GAGGTGTATTTTGGGTGAGGTGG - Intergenic
964702784 3:159587566-159587588 AATGTAAATTATGAGTTAAGGGG - Intronic
965492211 3:169351892-169351914 TAGGTGAATTTGGACTAAAGAGG - Intronic
965582147 3:170280024-170280046 TGGATGAATTTTGAGATAAGAGG - Intronic
966654223 3:182335884-182335906 GTGGTGATTTTTAATTTAAGTGG - Intergenic
966935785 3:184708065-184708087 GAGATGAAATCTGAGTCAAGAGG - Intergenic
967131145 3:186471787-186471809 GTGGTGTTATTTGAGTTAAGTGG + Intergenic
967554871 3:190845033-190845055 GTGTTGAATTTTGAGTTGAGTGG - Intergenic
969913054 4:10462407-10462429 AAGGTGATTTTTGAGTTGAGAGG - Intergenic
972109287 4:35536208-35536230 GATGTGAATGATGAGTTAATGGG - Intergenic
974756945 4:66221795-66221817 GACTTGAATGTTGAGTTAAGAGG + Intergenic
975841222 4:78476027-78476049 GAAGTGAAGTTTGAGAGAAGCGG + Intronic
978458803 4:108927293-108927315 GAAGTGGATTTTTAGTCAAGTGG - Intronic
979007935 4:115326739-115326761 GATGTGAATTTTGTGTGAGGTGG - Intergenic
982887831 4:160805595-160805617 GAAATGAGTTTTTAGTTAAGGGG - Intergenic
983108130 4:163715610-163715632 GAGGTGAATTTTAATCTCAGTGG + Intronic
983334081 4:166370594-166370616 AATGTGAATTATGAGTTAATGGG - Intergenic
983633356 4:169872565-169872587 GAGGTGAGTTTTGAGTGATGTGG + Intergenic
985866371 5:2517424-2517446 AGGGTGAGTTTGGAGTTAAGTGG + Intergenic
986108068 5:4679704-4679726 GAGGTTAATTATGGGTAAAGGGG - Intergenic
986748381 5:10763143-10763165 GTGGTGAGTTTGGAGTTCAGTGG - Intergenic
991129858 5:63110121-63110143 GAAGTGAATTTTGAGAGAAATGG - Intergenic
991583195 5:68177782-68177804 GAGGTAAATTTTGAGCTGATGGG + Intergenic
992159893 5:73991165-73991187 GTTGTCCATTTTGAGTTAAGTGG - Intergenic
995779341 5:115759155-115759177 GAAATGAATTTTGAGATTAGAGG + Intergenic
997093411 5:130883345-130883367 GAGTTGCAGTTTGAGTTCAGAGG + Intergenic
999288937 5:150410948-150410970 GAGGTGCATTTTGTGGGAAGGGG - Intronic
1003618652 6:7677880-7677902 GAGGTGAAATAAGAGTTAGGAGG - Intergenic
1005356938 6:24993994-24994016 GAGTTGATTCTTGAGTTAACTGG + Intronic
1006450378 6:34102577-34102599 GAGGTGAAGGTGGAGTTCAGGGG - Intronic
1008273152 6:49513333-49513355 AGGGTGAATGTTGAGTTGAGGGG - Intronic
1008430343 6:51409492-51409514 GAGGTGAATTTTGCCTTTAAAGG - Intergenic
1009775216 6:68196611-68196633 GGGGGGAATGATGAGTTAAGGGG + Intergenic
1011143947 6:84191263-84191285 GAAGTGAATTTTAGGTTGAGGGG - Intronic
1016263699 6:142206922-142206944 GAGTTAAATTTTGAGATGAGTGG - Intronic
1018019682 6:159748932-159748954 GAGGTGAATTTTGCCTTTAAAGG + Intronic
1020351534 7:7224816-7224838 GAGGTGAATTGTGTGTCATGGGG + Intronic
1020869629 7:13611418-13611440 GAGGTGGAGTTTGAGGTGAGCGG - Intergenic
1023036040 7:36132141-36132163 GAGGTGAAATTTGAGATGACAGG + Intergenic
1024386940 7:48762456-48762478 AGGGTGAATTTTGACTTGAGAGG + Intergenic
1028569166 7:92266959-92266981 AGGATGAATTTTGAGTTGAGAGG + Intronic
1028603435 7:92628591-92628613 GAAGTGAATTTTGAGACAGGAGG - Intronic
1030762834 7:113372209-113372231 GAGGTTATTTCAGAGTTAAGGGG - Intergenic
1031055256 7:116986272-116986294 GTGGTGAATTGAGAGTTGAGGGG + Intronic
1031744316 7:125474099-125474121 AAGGTGGATTTTGAGTTCCGAGG + Intergenic
1037271169 8:17131882-17131904 ATGGTGAATTTGGAGCTAAGAGG + Intergenic
1037646682 8:20798895-20798917 AAGAAGAATTTTGAGTTGAGAGG + Intergenic
1038968604 8:32605044-32605066 AATGTTAATTTTGAATTAAGAGG - Intronic
1039350597 8:36759633-36759655 GGGGTGAATTGTGAGATTAGTGG + Intergenic
1042519647 8:69697914-69697936 CAGGTAAATTATGTGTTAAGCGG + Intronic
1042757182 8:72227967-72227989 GAGGTGAAGTATGAGTCAAAAGG - Intergenic
1043136474 8:76532696-76532718 GAGGAAAATTTTGTGTTAAATGG - Intergenic
1044670387 8:94674434-94674456 GAGATGAACTTTGTGTTAATGGG + Exonic
1046335073 8:112774791-112774813 AAGGTGAAATGTGAATTAAGAGG - Intronic
1047466889 8:125125420-125125442 AGGGTGAATTTTGAGCTGAGAGG + Intronic
1047891072 8:129311177-129311199 TAGATCAATTTTGAGTTAACTGG + Intergenic
1050037705 9:1454636-1454658 GAGGTGATATTTGAGTGATGAGG + Intergenic
1051137293 9:13936540-13936562 GAGGTGAGTTTTAGGTGAAGGGG - Intergenic
1053251997 9:36582306-36582328 TTGGAGAGTTTTGAGTTAAGGGG + Intronic
1055820394 9:80254804-80254826 GTGGTGAATCTTGGGATAAGGGG + Intergenic
1056878130 9:90357924-90357946 GAGGTGAAGTAGGAGTGAAGGGG + Intergenic
1058346122 9:103965162-103965184 GAGCTTAATTTTTGGTTAAGGGG - Intergenic
1058908415 9:109499248-109499270 GCAGTGAATTTTCAGTGAAGCGG + Intergenic
1186010017 X:5119823-5119845 AAGGTTAATTTTTATTTAAGAGG + Intergenic
1186807208 X:13152346-13152368 GGGCTGAATTTTGATTTAAAAGG + Intergenic
1187102792 X:16212388-16212410 AGGGTGAATTTGGAGTTGAGAGG - Intergenic
1187333291 X:18360362-18360384 GAAGTGACATTTGAGTTGAGAGG + Intergenic
1188105962 X:26147143-26147165 GGGCTGAATTTTGAGGAAAGGGG - Intergenic
1188727156 X:33599917-33599939 GATGTGAATGTTAAGTTAATTGG - Intergenic
1188846399 X:35077187-35077209 GAGGGGAATTGTGATTTTAGTGG - Intergenic
1188956629 X:36441589-36441611 GTGGTGATTTTGGAGGTAAGAGG + Intergenic
1190167519 X:48085372-48085394 GAGGTGCAGTTTGACTTCAGAGG - Intergenic
1191213733 X:57914760-57914782 CTGGTGAATTTGGAGCTAAGAGG + Intergenic
1193601492 X:83512032-83512054 GATGTGAAGTTTTAGTCAAGGGG + Intergenic
1194784407 X:98064145-98064167 GAGATGAGGTTTGAGTAAAGGGG - Intergenic
1196822275 X:119711379-119711401 GAGGTGAATTTAGTGGTATGTGG + Intergenic
1197839236 X:130727940-130727962 AGGGTGAATTTGGAGCTAAGAGG - Intronic