ID: 962938070

View in Genome Browser
Species Human (GRCh38)
Location 3:140099951-140099973
Sequence GTGGGTAATCAGGTGTTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 94}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962938061_962938070 21 Left 962938061 3:140099907-140099929 CCTGAGGCAGCAGCACATGCCCT 0: 1
1: 0
2: 3
3: 30
4: 325
Right 962938070 3:140099951-140099973 GTGGGTAATCAGGTGTTGCAGGG 0: 1
1: 0
2: 0
3: 1
4: 94
962938062_962938070 2 Left 962938062 3:140099926-140099948 CCCTCATGACCTACTTTCTCTGG 0: 1
1: 0
2: 1
3: 18
4: 186
Right 962938070 3:140099951-140099973 GTGGGTAATCAGGTGTTGCAGGG 0: 1
1: 0
2: 0
3: 1
4: 94
962938067_962938070 -7 Left 962938067 3:140099935-140099957 CCTACTTTCTCTGGCAGTGGGTA 0: 1
1: 0
2: 0
3: 12
4: 126
Right 962938070 3:140099951-140099973 GTGGGTAATCAGGTGTTGCAGGG 0: 1
1: 0
2: 0
3: 1
4: 94
962938064_962938070 1 Left 962938064 3:140099927-140099949 CCTCATGACCTACTTTCTCTGGC 0: 1
1: 0
2: 3
3: 21
4: 189
Right 962938070 3:140099951-140099973 GTGGGTAATCAGGTGTTGCAGGG 0: 1
1: 0
2: 0
3: 1
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962938070 Original CRISPR GTGGGTAATCAGGTGTTGCA GGG Intronic
901874005 1:12155727-12155749 CTGGGTGTTCAGGTGTGGCAGGG - Intergenic
902332754 1:15738546-15738568 GTGGGTAGAGAGCTGTTGCAGGG + Intronic
907097268 1:51793084-51793106 CTGACTAATCAGGTCTTGCAAGG - Intronic
907851437 1:58258778-58258800 GTGGGTTAGTAGGTGTTGAAGGG + Intronic
908200738 1:61792864-61792886 CTGGGTAATTAGGGGTGGCAGGG + Intronic
912876292 1:113363148-113363170 GTGGGAAATCAGGGGTCTCACGG - Intergenic
917085885 1:171305709-171305731 GTCGGTAACCAGGTGCTGAATGG - Intergenic
917840525 1:178973856-178973878 GGGGGTATTCATGTGTTGCCTGG - Intergenic
918709273 1:187706620-187706642 GTGGGTGTCCAGGTGGTGCAGGG + Intergenic
921226507 1:213025566-213025588 GTGGGAAATCAGGGGTCTCACGG + Intergenic
922636896 1:227182798-227182820 GTGGGCAAGCAGGTGTTAGAAGG + Intronic
922642015 1:227243855-227243877 TTGGGTAAGTAGGAGTTGCATGG - Intronic
1064565185 10:16632571-16632593 GTGGAAAATCAGGTGTTGTGGGG - Intronic
1068064560 10:52112452-52112474 ATGGGTAATGAGGTATTTCATGG + Intronic
1069748616 10:70731817-70731839 GTGGGTAGCGGGGTGTTGCAGGG + Intronic
1072206855 10:93212370-93212392 GTGGCCAAGCAGGTGTTGCCTGG + Intergenic
1073446827 10:103585967-103585989 GTCAGTAGTCAGGTGGTGCAGGG + Intronic
1074897387 10:117789093-117789115 GTGAGTAATCTTGTGTTGCCTGG + Intergenic
1076416187 10:130291214-130291236 GTGGGAAATCAGGGGTCTCACGG - Intergenic
1076416893 10:130297681-130297703 GTGGGAAATCAGGGGTCTCACGG - Intergenic
1076919696 10:133445244-133445266 CTGGGGGATCAGGTGTTGGAGGG + Intergenic
1077416258 11:2425679-2425701 GCGGGTGACCAGGTGTGGCAGGG - Intergenic
1090480552 11:127064108-127064130 GTGGCTTATTAGGTCTTGCATGG + Intergenic
1093368340 12:18332833-18332855 GTAGGTAATCAGCTGTTTCTGGG - Intronic
1093905523 12:24687325-24687347 AAGGGTAATCAGGTGTTTGATGG - Intergenic
1095906201 12:47380560-47380582 GTAGGAAAACAGCTGTTGCATGG - Intergenic
1097255946 12:57674731-57674753 GTGGCTAAGCAGGTGCTGCTGGG + Intergenic
1098127260 12:67311236-67311258 ATGGGTTATCAGGTTTTACATGG + Intronic
1099493177 12:83311014-83311036 TTAGGTAATGAAGTGTTGCATGG + Intergenic
1099562783 12:84198768-84198790 GCAGGTAAGCAGGTGTTTCAAGG - Intergenic
1102040117 12:109795376-109795398 GAGGGAAATGAGGTCTTGCAAGG + Intronic
1102169213 12:110829286-110829308 GAGGGTAATCAGGTCTGGCCGGG + Intergenic
1102919687 12:116782615-116782637 GGAGGAAATCAGGTGTGGCAGGG - Intronic
1108083001 13:46756818-46756840 GTGGGGGATCAGGGGGTGCAGGG - Intergenic
1110201741 13:72858596-72858618 GAAGGAAATTAGGTGTTGCATGG + Intronic
1112997291 13:105589776-105589798 GTGGCTGATCAGCTGTTACATGG - Intergenic
1124270315 15:28274654-28274676 GTCTGTACTCAGGTGTTCCATGG + Intronic
1128721192 15:69949770-69949792 GTGGGCAATCAGCTGTAGCCTGG + Intergenic
1129225503 15:74168206-74168228 GTGGGTGGGGAGGTGTTGCATGG + Intergenic
1129957234 15:79650166-79650188 GAGGATAATCAGGTGTGGCAGGG - Intergenic
1131261957 15:90892197-90892219 GTGGGGAATCAGATGGGGCAGGG - Intronic
1135626433 16:23999125-23999147 GTGGGCAAGCAGGTGTGGCTAGG - Intronic
1140707647 16:77645498-77645520 CTGGGGACTCAGTTGTTGCATGG + Intergenic
1142555587 17:774582-774604 GTGGGTACTCAGGGATGGCATGG - Intronic
1151788203 17:76286914-76286936 GGAGGTAAACAGGTGTTGTAGGG + Intronic
1159103179 18:63977664-63977686 GGAAGTAAGCAGGTGTTGCAGGG + Intronic
1159198503 18:65150205-65150227 GTGGGTAATCAGGTCAAGTATGG - Intergenic
1159686409 18:71426149-71426171 ATGAGTATTCAGGTGTTGAAAGG + Intergenic
1159971209 18:74656694-74656716 GTGGTTCATCAGGTGCTACAGGG - Intronic
1163006074 19:14397427-14397449 GTGAGTCATCAGCTGTTGCCTGG - Intronic
1163061671 19:14766013-14766035 GTGAGTCATCAGCTGTTGCCTGG + Intronic
1164782168 19:30901546-30901568 GTGGGAAATCAGGTGGGGCCGGG + Intergenic
1165866290 19:38941412-38941434 GTGGGAAATCAGGGGTCTCACGG + Exonic
1165991623 19:39818499-39818521 GTGGGTGGGCAGGTGTGGCAGGG - Intergenic
930500266 2:52207504-52207526 GTGGCTAATCATGTTTTGGATGG - Intergenic
933291470 2:80442934-80442956 GTGGGTATTTAGGAGATGCATGG - Intronic
940028446 2:149234344-149234366 TTGGGGAAACAGGTGTTTCATGG - Intergenic
946022520 2:216650852-216650874 GAAGGATATCAGGTGTTGCATGG + Intronic
1168874820 20:1164277-1164299 TTAGGTAAGCAGGTGTGGCAAGG - Intronic
1171110289 20:22474348-22474370 GTGGGTAATCAGCTCTTATAAGG + Intergenic
1175661850 20:60820332-60820354 GTGGGTCATCACGTGCAGCAAGG - Intergenic
1179532718 21:42031094-42031116 GTGTGAAAGCAGGTGTTTCAGGG - Intergenic
1184235669 22:43181854-43181876 GTGGGTGACCACGTGATGCAGGG + Intronic
949167076 3:955708-955730 ATGGGTAATAAGGTGAGGCAAGG - Intergenic
953325916 3:42012871-42012893 ATGAGAAATCAGGTTTTGCAGGG + Intergenic
957814910 3:85284816-85284838 GTGGGTAGTCATGTTTTGAATGG + Intronic
957901719 3:86502724-86502746 GTGAGTAAAGAGGAGTTGCATGG + Intergenic
962500132 3:135982774-135982796 GTGTGTATGCATGTGTTGCAGGG - Intronic
962938070 3:140099951-140099973 GTGGGTAATCAGGTGTTGCAGGG + Intronic
964325485 3:155541529-155541551 ATGGGGAATCAGGTGGTTCATGG + Intronic
968081699 3:195850738-195850760 GTAGGTGATCAAGAGTTGCACGG - Intergenic
968335835 3:197912879-197912901 GTTGGTGAACAGGAGTTGCAGGG - Intronic
970772711 4:19634605-19634627 GTGGGAAATCAGGGGTCTCACGG - Intergenic
971719066 4:30221223-30221245 ATTGGTAAGCAGGTGTTGAAAGG - Intergenic
983548834 4:168994056-168994078 GTGGGAAATCAGGGGTCTCACGG + Intronic
1010034038 6:71301335-71301357 GGGGGAAATCAGGTGTAGGAAGG - Intronic
1011261353 6:85473242-85473264 GAGGGTAATCAGGCATTGAAAGG - Intronic
1014260663 6:119212902-119212924 GTGGGTAATCAACTGTTTTAAGG + Intronic
1017723048 6:157257853-157257875 GCGGGTGATCAGGAGTTGGAAGG + Intergenic
1023996263 7:45160913-45160935 GTGGGTTGTCAGGTTTTGCTGGG + Intronic
1031786098 7:126034931-126034953 ATTAGTAATCAGGTGTTCCATGG - Intergenic
1036712847 8:11092953-11092975 GTGGGTAGTCAAGGGCTGCATGG - Intronic
1037191713 8:16134013-16134035 GTGGATAGTCAGCTGCTGCAGGG + Intronic
1041096806 8:54358404-54358426 GGTGGTTATCAGGTGCTGCAGGG - Intergenic
1041944084 8:63422616-63422638 GGGGGTAATGAGATGTTGAAGGG - Intergenic
1043285559 8:78525151-78525173 CTGGGTAAACAGATGGTGCATGG - Intronic
1049314657 8:141957333-141957355 ATGGGGCATCAGGTGTTGAAAGG + Intergenic
1052260136 9:26505514-26505536 GTGGGGAATCAGATTTTGGAAGG - Intergenic
1056299665 9:85227930-85227952 GTGGGTACCCAGGTGATGTACGG + Intergenic
1062428825 9:136517982-136518004 GTGTGCAGTGAGGTGTTGCAGGG - Intronic
1188100184 X:26073130-26073152 GAGGTTAATCAGGTGGTGTAAGG - Intergenic
1189073321 X:37888130-37888152 GATGGAAATCAGGTGGTGCATGG + Intronic
1189125416 X:38440474-38440496 GTGTGTGATCAAGAGTTGCATGG - Intronic
1195553725 X:106197499-106197521 GAAGGTAATCAGCTGTTGCTGGG - Intronic
1196135462 X:112204672-112204694 ATGGGTAGTGAGGGGTTGCAAGG + Intergenic
1197617847 X:128714753-128714775 GTGGTTGTTCAGGTCTTGCATGG - Intergenic