ID: 962940278

View in Genome Browser
Species Human (GRCh38)
Location 3:140119074-140119096
Sequence CAGGCATTTTGCCCCTCCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 170}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962940278_962940284 -9 Left 962940278 3:140119074-140119096 CCCCAGGAGGGGCAAAATGCCTG 0: 1
1: 0
2: 2
3: 14
4: 170
Right 962940284 3:140119088-140119110 AAATGCCTGCTTTGGAAGTGGGG 0: 1
1: 0
2: 2
3: 19
4: 237
962940278_962940283 -10 Left 962940278 3:140119074-140119096 CCCCAGGAGGGGCAAAATGCCTG 0: 1
1: 0
2: 2
3: 14
4: 170
Right 962940283 3:140119087-140119109 AAAATGCCTGCTTTGGAAGTGGG 0: 1
1: 0
2: 5
3: 29
4: 263
962940278_962940286 23 Left 962940278 3:140119074-140119096 CCCCAGGAGGGGCAAAATGCCTG 0: 1
1: 0
2: 2
3: 14
4: 170
Right 962940286 3:140119120-140119142 TCATAGCTTGAGATTGTAACAGG 0: 1
1: 0
2: 1
3: 5
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962940278 Original CRISPR CAGGCATTTTGCCCCTCCTG GGG (reversed) Intronic
900287230 1:1907513-1907535 CAGGGGTGCTGCCCCTCCTGGGG + Intergenic
900417683 1:2542651-2542673 CAGGTGTTTGGCCCTTCCTGTGG + Intergenic
904605632 1:31696249-31696271 CTGGCATCTGGCACCTCCTGGGG + Intronic
907909183 1:58812244-58812266 CAGGCATTTTCCCCCCTCTTTGG + Intergenic
908856862 1:68439951-68439973 AAGGCATTTTGACCATTCTGAGG - Intronic
912181172 1:107220804-107220826 CAGGCACTATACCCTTCCTGTGG + Intronic
912414322 1:109497878-109497900 AACTCATTATGCCCCTCCTGGGG + Intronic
914666812 1:149839517-149839539 CTGCCATTTTGCCTTTCCTGAGG - Exonic
914668955 1:149854273-149854295 CTGCCATTTTGCCTTTCCTGAGG + Exonic
914805178 1:150986258-150986280 CAGGCATTTGGCAGGTCCTGGGG + Intronic
915869126 1:159538948-159538970 GTGGCAGTTTGCCCCTACTGGGG - Intergenic
916947304 1:169741767-169741789 CAGACTTCTTGCCCCTCCTTGGG - Intronic
917418940 1:174842325-174842347 CACACATTTTCCCTCTCCTGAGG + Intronic
917634216 1:176919166-176919188 CAGGGATTATGCCTCTCATGCGG + Intronic
917669235 1:177256803-177256825 CAAGGCTTTTGCCCTTCCTGAGG + Intronic
918797926 1:188929191-188929213 CATGTATTTTGCTCCTGCTGTGG + Intergenic
920973985 1:210768524-210768546 CAGGCATGTTGCCTCACGTGTGG - Intronic
921531183 1:216284903-216284925 GTGGCATTTTGCCCCTCCCCTGG + Intronic
924596000 1:245445159-245445181 AAGGCATTTTTCTCCTCCTTGGG + Intronic
1063335936 10:5213310-5213332 CACCCATGCTGCCCCTCCTGTGG - Intronic
1063913807 10:10860392-10860414 CAGGCATTTTGACCCACAGGTGG - Intergenic
1064310684 10:14209276-14209298 CTGGCATTTTAACACTCCTGTGG + Intronic
1064994068 10:21281105-21281127 CAGGCATTTTGTCTTTCCTTTGG - Intergenic
1066164703 10:32774149-32774171 CAGGAATTTGGTCCTTCCTGTGG + Intronic
1067689660 10:48493640-48493662 GAGGCCTTTTGTCTCTCCTGGGG + Intronic
1068832504 10:61512789-61512811 CAGGTATTTTTCCCCATCTGTGG + Intergenic
1069077443 10:64052749-64052771 GAGGCATTTTGCCCCTGCCCTGG - Intergenic
1069543433 10:69312696-69312718 CAGGCATTTTATCCCTCTAGGGG + Intronic
1074489118 10:113923107-113923129 CTGGCAGCCTGCCCCTCCTGGGG - Intergenic
1074634251 10:115295587-115295609 CAGGCATGTAGCCGCTCCTCTGG + Intronic
1077054058 11:581636-581658 CAGGCACCCTGCTCCTCCTGGGG - Intronic
1083597943 11:63928364-63928386 CAGGCATTTTACCTTTCCTAAGG + Intergenic
1085216978 11:74841824-74841846 CAGGCAGATTGCCCCTTCTTGGG + Exonic
1085610558 11:77945051-77945073 CAGGGATTTTGCCCTTTCTCTGG - Intronic
1087129296 11:94654571-94654593 CAGGCAACTTGGCCATCCTGAGG - Intergenic
1091356712 11:134943256-134943278 CAGGCCTTTTGCCCCAGCTGTGG - Intergenic
1091401806 12:185733-185755 CAGGCCATCTGCCCCTGCTGTGG + Intergenic
1091909603 12:4218886-4218908 CAGTCAATGTGCCCATCCTGTGG + Intergenic
1091992201 12:4964411-4964433 CAGCCATTGTGCCCTTCTTGGGG + Intergenic
1093919473 12:24843881-24843903 CAGGCATTTTCTCCCTTCTGGGG + Intronic
1095699633 12:45177532-45177554 CCAGCATTTAGCCTCTCCTGAGG + Intergenic
1097141871 12:56908855-56908877 CAGGCATTTTTGCACTCTTGGGG + Intergenic
1098272726 12:68784569-68784591 CAGGCATTGTGCCAGTACTGGGG - Intronic
1098674275 12:73268972-73268994 CAGTCATTTTGCATTTCCTGAGG - Intergenic
1098915255 12:76250698-76250720 CAGGCACTTCGCCCTTCCTGAGG + Intergenic
1109947155 13:69450682-69450704 CAAGCATTTTCTCTCTCCTGTGG - Intergenic
1110926943 13:81165178-81165200 GAGGCATTTTGCCCCTTCCCTGG - Intergenic
1111302555 13:86364345-86364367 CAGGCATTTATGCTCTCCTGAGG + Intergenic
1112287626 13:98118163-98118185 CAGGCATTTTCCACCTGGTGAGG + Intergenic
1112686286 13:101831589-101831611 AAGCCATTTTGTCTCTCCTGGGG - Intronic
1113702809 13:112399648-112399670 GAGGTATTTTGCCCCTCCATGGG - Intronic
1114701352 14:24681479-24681501 CTGGCATTTTGCTTATCCTGTGG + Intergenic
1115273499 14:31580734-31580756 CAGGGCTTTTGCTCTTCCTGTGG - Intronic
1115417367 14:33152023-33152045 GAGTGATTTTGCCCCTCCTGAGG + Intronic
1116785434 14:49282529-49282551 AAGGAATTATGCACCTCCTGTGG - Intergenic
1118083016 14:62383377-62383399 AAGGCATTTTGCACCCCCTTTGG - Intergenic
1118751062 14:68808235-68808257 CAGGCATGCTTCCCATCCTGGGG - Intergenic
1118905078 14:70017904-70017926 CAGGCATTTTCCCACTCATAAGG - Intronic
1119649696 14:76374939-76374961 CAGGCGGCTGGCCCCTCCTGGGG + Intronic
1120245235 14:81998407-81998429 AAGACATCTTTCCCCTCCTGTGG + Intergenic
1121642262 14:95493633-95493655 CAGGCATTTTGCCCATCCCATGG - Intergenic
1122369746 14:101222921-101222943 CAGGCTGTGTGCCCCTCCTGGGG + Intergenic
1122588824 14:102830644-102830666 CATGCCCTTTGCCCCTCCTATGG - Intronic
1124849003 15:33317763-33317785 CATGCACTTTTCCCCTCCTCTGG + Intronic
1125274974 15:37979818-37979840 CAGCCATCTCACCCCTCCTGGGG - Intergenic
1125601368 15:40917625-40917647 CAGGCTTTTTTCTCCTCTTGAGG + Intergenic
1126488596 15:49211224-49211246 GAGGCATTGTGCCCCTGCTCTGG - Intronic
1130299086 15:82666596-82666618 CACTCCTTTTGTCCCTCCTGTGG - Intronic
1133139599 16:3734482-3734504 CAGGCAGGTGCCCCCTCCTGGGG + Intronic
1134089824 16:11385466-11385488 CAGGCATTGGGCTCCTACTGCGG - Intronic
1134768195 16:16780931-16780953 CAGGCACACTGGCCCTCCTGAGG - Intergenic
1134893199 16:17859941-17859963 CACGCATTTTTCCCCTACTTGGG + Intergenic
1137810341 16:51346606-51346628 CATGCCTTTTGCACATCCTGGGG + Intergenic
1140751790 16:78031006-78031028 TTGGGATTTTGCCCTTCCTGGGG + Exonic
1147614784 17:41821553-41821575 CAGGCCAGTTTCCCCTCCTGGGG - Intronic
1152700318 17:81815308-81815330 CAGGCACTGGGGCCCTCCTGGGG + Intergenic
1153814666 18:8782211-8782233 CAGGCCTGTCGCCCCTTCTGTGG - Intronic
1154497957 18:14976048-14976070 CAGGCCTTTTGCCCCAGCTGTGG + Intergenic
1155190274 18:23423374-23423396 CAGGCAATCTTCCCCTCCAGGGG + Intronic
1155625352 18:27828161-27828183 CAGACATTCTCCCCTTCCTGGGG + Intergenic
1156804150 18:41156292-41156314 AAGGCACTTGGCCCCTCTTGTGG + Intergenic
1162794143 19:13078078-13078100 TGGGCATTGTGTCCCTCCTGAGG + Intronic
1164686540 19:30169809-30169831 CAGGCACTGTCCCCATCCTGAGG - Intergenic
1165615018 19:37192122-37192144 CAGTCATTATGCTACTCCTGAGG + Intronic
925001284 2:404727-404749 CTGGCATTTTGCCCCTGCCCTGG - Intergenic
925329805 2:3049777-3049799 GATGCATTTTGCACCTCCTTTGG + Intergenic
925967002 2:9075600-9075622 AAGACATTTTGGCCCTGCTGGGG + Intergenic
928856787 2:35812173-35812195 CAGGGCTTTTGCCTCTGCTGTGG - Intergenic
929750170 2:44703060-44703082 CAGGCATCTTGCACTTCCTAAGG - Intronic
929990312 2:46781058-46781080 CTGGCTTTCTGCCCCTCGTGGGG - Intergenic
931644402 2:64408434-64408456 CATTCCTTTTCCCCCTCCTGTGG - Intergenic
932335950 2:70931530-70931552 CAGGCATCTGGCCCCTCCTCTGG + Intronic
932749586 2:74362919-74362941 CAGGGATTTAGCCCCTGCTCAGG - Intronic
933215841 2:79629120-79629142 CAGCCATATTGGCCCTCGTGTGG + Intronic
933852567 2:86382358-86382380 CAGGGATTTGGGCCTTCCTGTGG + Intergenic
935655826 2:105421974-105421996 TCAGCTTTTTGCCCCTCCTGGGG + Intronic
940234779 2:151498395-151498417 CAGTCATTTTCCCCCTGCTTTGG + Intronic
940817037 2:158308741-158308763 CATGCACTGTGACCCTCCTGTGG + Intronic
944125910 2:196292525-196292547 CAGGCATTTGGCACTCCCTGAGG + Intronic
944635964 2:201676390-201676412 CAGGCATGCTTCCCCTCCTTAGG + Intronic
1173183179 20:40819954-40819976 TAGGGATTTTGCCCCTCATGGGG + Intergenic
1173549548 20:43923135-43923157 CAGGCAGGTTTCCCCTCCTTAGG - Intronic
1174543088 20:51304921-51304943 CAGGCCTCCTGTCCCTCCTGGGG - Intergenic
1174622469 20:51886387-51886409 CAGGCATTGTGGACCTCGTGAGG + Intergenic
1175321284 20:58090164-58090186 TAGGAATTTTGCAGCTCCTGTGG - Intergenic
1175971668 20:62689624-62689646 CCCGCATTGAGCCCCTCCTGGGG + Intergenic
1184450051 22:44577392-44577414 CAGGCAGTAAGCCCCTCATGGGG - Intergenic
949102807 3:166190-166212 CAGTCATTTTGCCCTGTCTGGGG + Intergenic
951058312 3:18173605-18173627 GAGGCATTTTGCCCCTGCCCTGG - Intronic
952499068 3:33942508-33942530 CAGAGATTTTGCCCCTCTGGTGG - Intergenic
954258227 3:49420781-49420803 CAGGCTTTTTGTCCATCCAGTGG - Intronic
954272409 3:49520122-49520144 CAGGCCTTTGTCCCCACCTGAGG - Intronic
954425361 3:50440218-50440240 CAGGCCTTAGCCCCCTCCTGGGG - Intronic
955506801 3:59640526-59640548 CAGGCACTGTTCCCCTCCTCCGG - Intergenic
957504790 3:81105848-81105870 GAGGCATTTTGCTTCTCATGCGG - Intergenic
958108894 3:89114161-89114183 AAGGCAGTTATCCCCTCCTGTGG - Intronic
958562022 3:95759496-95759518 CATGCATTTTCTCCCTTCTGAGG - Intergenic
959459336 3:106605086-106605108 CAGGAATTTTGCCACTCCCCTGG + Intergenic
959560737 3:107777598-107777620 CAGGCATGTTGCCATTGCTGTGG + Intronic
961943917 3:130665933-130665955 CTGGCATTATGTGCCTCCTGAGG + Intronic
962384722 3:134923479-134923501 CAGGCCCTTTGGCCCCCCTGCGG + Intronic
962895030 3:139706461-139706483 GAGGCCTCTTGCCCCTCCTCTGG + Intergenic
962940278 3:140119074-140119096 CAGGCATTTTGCCCCTCCTGGGG - Intronic
963475894 3:145803750-145803772 CAGGCTTTTGGTCCCACCTGGGG - Intergenic
965277630 3:166706053-166706075 CTGGCATATTGCCCCTTCTCTGG + Intergenic
965851905 3:173037880-173037902 CAGGCATTTTGCAAATCCTGTGG - Intronic
966216978 3:177514012-177514034 CAGGCATTTTGACTTTCCAGTGG - Intergenic
969112311 4:4851688-4851710 CAGGTATCTTGACCTTCCTGGGG + Intergenic
969189250 4:5503554-5503576 CATGCACTGTGCCTCTCCTGTGG + Intergenic
971076160 4:23151977-23151999 CAGGGAGTTCGCTCCTCCTGGGG + Intergenic
971441460 4:26692204-26692226 CTGGCCATCTGCCCCTCCTGTGG - Intronic
974020013 4:56684805-56684827 CAGGCATTGTTCCTCTCTTGCGG - Intergenic
975448735 4:74500124-74500146 GAGGCATTTTGCCATTACTGGGG - Intergenic
978362117 4:107942148-107942170 CAGAAATTCTGCCTCTCCTGGGG + Intronic
980023362 4:127735576-127735598 CAGACATTTTGTGCCTACTGGGG - Intronic
982537159 4:156620971-156620993 CTGGCATCTTGCCCCTGCTTAGG - Intergenic
983458274 4:167992943-167992965 CAAACATTTTTCCCCTTCTGTGG + Intergenic
983581900 4:169317668-169317690 GAGGGATATTGCCCCTTCTGGGG - Intergenic
986516729 5:8572356-8572378 CAGGCCTTTTGCACATACTGAGG - Intergenic
987770628 5:22299166-22299188 CAGTCATGTTCCCTCTCCTGAGG - Intronic
988450826 5:31341502-31341524 CAGGGACTTTGTCCCACCTGTGG - Intergenic
992131625 5:73698741-73698763 CAGTCCATTTGCCTCTCCTGTGG - Intronic
994790114 5:104213972-104213994 CAGCCAGTTTTCCCCTCCTTTGG - Intergenic
996829250 5:127721341-127721363 GAGGCATTTTGCCTCTGCTCTGG - Intergenic
997510717 5:134451947-134451969 CAGGAATTTTGCCCCTTGAGGGG + Intergenic
999958927 5:156733397-156733419 CAGTCATTTTGCGTCTGCTGAGG + Intronic
1000253334 5:159515388-159515410 CAGGCATTGTGCCCTTAATGTGG + Intergenic
1000896937 5:166866837-166866859 CAAGCAATTTCCCCCTCCTCTGG - Intergenic
1001121082 5:168980365-168980387 CATGCATTTTGAGCCTTCTGTGG - Intronic
1001660339 5:173386676-173386698 CATGTACTTTGCCCATCCTGGGG - Intergenic
1001695208 5:173664727-173664749 CAGACATTAGGCCACTCCTGTGG + Intergenic
1003093348 6:3122591-3122613 CTGGCATTATGCCTGTCCTGAGG + Intronic
1007632559 6:43280888-43280910 CAGGCAGTTTCCTCCACCTGGGG - Intronic
1008619736 6:53260031-53260053 CAGGCATCTTGCCAGTGCTGGGG - Intergenic
1010155804 6:72791177-72791199 CAGGCATTTAGCTCCTCCTGTGG - Intronic
1013143012 6:107358870-107358892 AAGGCAGTTTTGCCCTCCTGGGG - Intronic
1016741254 6:147531490-147531512 CAGGCATTATGCCGGGCCTGGGG - Intronic
1018405368 6:163475944-163475966 CAAGTATTTTTCCCATCCTGTGG - Intronic
1018469486 6:164083134-164083156 CTGCCACTTTGCCCCTCCTCTGG - Intergenic
1019205231 6:170355972-170355994 CAGGCGGTGTGTCCCTCCTGGGG - Intronic
1021175060 7:17440539-17440561 GAGGCATTTTGCCCCTGCCCTGG - Intergenic
1021515595 7:21481233-21481255 CAGACATCTTGCCCCTCCTGGGG + Intronic
1022792406 7:33702090-33702112 CAGGCATTCTGCCAGTTCTGGGG + Intergenic
1025842545 7:65163988-65164010 CAGGGATTTTGCCCTTTCTCTGG + Intergenic
1025880500 7:65531981-65532003 CAGGGATTTTGCCCTTTCTCTGG - Intergenic
1025892937 7:65670623-65670645 CAGGGATTTTGCCCTTTCTCTGG + Intergenic
1027825802 7:83114193-83114215 CAGGCATTTTGATAGTCCTGAGG + Intronic
1030567025 7:111170388-111170410 CTGGACTTTTGCCCCTTCTGTGG - Intronic
1032920713 7:136543359-136543381 CAGGCAGTTTTCCCCTCTGGGGG - Intergenic
1033152127 7:138924686-138924708 CAGCCGCTTTGTCCCTCCTGGGG - Intronic
1036464328 8:8982333-8982355 CAGCAATTTTGCCCCACATGGGG + Intergenic
1042671229 8:71265581-71265603 CAGGCATGGTCCCCCTCCTGTGG - Intronic
1044712582 8:95072105-95072127 CAGGCATTGTGCTGGTCCTGAGG - Intronic
1048096218 8:131298118-131298140 CAGGAATTTTGCTTCTGCTGAGG + Intergenic
1048646516 8:136427067-136427089 CAGGAATTTAGCCACTCCTCTGG + Intergenic
1049403158 8:142439905-142439927 CAGCCATTTTGCCCCCACAGTGG + Intergenic
1054344379 9:63899970-63899992 CAGGCATGATCCCCCTGCTGCGG + Intergenic
1055140485 9:72871537-72871559 CAGGCATTTTGACTGTCCAGGGG - Intergenic
1055870072 9:80866302-80866324 CAGCCATTTTGTCTCCCCTGAGG - Intergenic
1058317110 9:103581800-103581822 GCGGCATTTTGCCCCTGCTCTGG - Intergenic
1061144394 9:128788661-128788683 CAGGAATCTGGCACCTCCTGCGG - Intronic
1187135342 X:16542509-16542531 CATGCATTTAGCCCCTTCTGTGG + Intergenic
1189528595 X:41854448-41854470 CGTGTATTTTCCCCCTCCTGGGG + Intronic
1191769570 X:64740583-64740605 CAGGTATTTTTCCCATCCTCTGG + Intergenic
1192572181 X:72215218-72215240 CAGGCATTTTCCACCTCCAGAGG - Intronic
1198038279 X:132822913-132822935 CAGGCATTTAGCCATTACTGGGG + Intronic
1200149480 X:153944258-153944280 CAGGGTTTTTGCCCTTCCTGAGG - Intronic