ID: 962944285

View in Genome Browser
Species Human (GRCh38)
Location 3:140153374-140153396
Sequence CCTTGCAGTGAGAATTTGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 162}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962944277_962944285 15 Left 962944277 3:140153336-140153358 CCTATTGAGTGTGTAACTCTTCA 0: 1
1: 0
2: 1
3: 10
4: 106
Right 962944285 3:140153374-140153396 CCTTGCAGTGAGAATTTGGCGGG 0: 1
1: 0
2: 0
3: 10
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962944285 Original CRISPR CCTTGCAGTGAGAATTTGGC GGG Intronic
901129003 1:6950533-6950555 ACCTGCAGTGAGCATGTGGCAGG - Intronic
901873157 1:12150360-12150382 CCATACAGTCAGAATGTGGCAGG + Intergenic
903231256 1:21923573-21923595 CCTTGCAGTGAGCCTGTGGGAGG - Intronic
903586003 1:24415718-24415740 CCTGCCAGTCAGAAGTTGGCAGG - Intronic
906841973 1:49148709-49148731 ACTAGCAGTGACAATTGGGCAGG + Intronic
911187600 1:94919087-94919109 CCTTGAAATGAAAATCTGGCTGG + Intronic
913562384 1:120034847-120034869 CCTTGAAGTGGGAATTAGACTGG + Intronic
913635740 1:120758760-120758782 CCTTGAAGTGGGAATTAGACTGG - Intergenic
914282972 1:146194228-146194250 CCTTGAAGTGGGAATTAGACTGG + Intronic
914544002 1:148644946-148644968 CCTTGAAGTGGGAATTAGACTGG + Intronic
914622622 1:149426064-149426086 CCTTGAAGTGGGAATTAGACTGG - Intergenic
919934889 1:202245037-202245059 GCTTGCAGGCAGATTTTGGCGGG - Intronic
920830232 1:209458008-209458030 CTTTGCAGAGAGAACTGGGCTGG + Intergenic
921836845 1:219787209-219787231 CCTGGCAGGGAGAATGGGGCTGG - Intronic
1063670492 10:8095903-8095925 TCATGCAATGAGAATCTGGCAGG - Intergenic
1064835841 10:19529081-19529103 CTTTGCTGTGAGAATGTGGGAGG - Intronic
1065847400 10:29757439-29757461 CCCTCCAGTGAGAAGTGGGCTGG - Intergenic
1069133600 10:64736320-64736342 CCATGGAGTGAGATTTTGGGAGG + Intergenic
1071785512 10:88895324-88895346 CCTTGTAGTCAGGACTTGGCTGG - Intronic
1074808203 10:117075431-117075453 CCTGGCATTAAGAATTTGCCCGG - Intronic
1074909842 10:117898263-117898285 CATTGCAGTGGGAATATGACGGG - Intergenic
1076214457 10:128681646-128681668 CCATGCAGTGTGAATTTACCGGG + Intergenic
1082626519 11:55494134-55494156 GGTTGCAGTCAGAAATTGGCTGG + Intergenic
1092070141 12:5625446-5625468 CTTTGAAGTGAGCATTTGGGTGG + Intronic
1096974460 12:55691925-55691947 GCTCGCAGTGAGAATGTGGTGGG - Intronic
1098295810 12:69003160-69003182 TCTTACAGTGAGAACTTGGGAGG - Intergenic
1098575508 12:72037552-72037574 ACTTGCAGTAATCATTTGGCTGG - Intronic
1099876858 12:88418450-88418472 CTATGCAGTAAGAATATGGCTGG - Intergenic
1100605950 12:96152312-96152334 AGTTGCAGTGAGAAGGTGGCTGG - Intergenic
1106001008 13:25723482-25723504 TCTTGTAGTTAGAATTTGCCTGG + Intronic
1106061075 13:26292704-26292726 ACTAGCAGTGATACTTTGGCTGG + Intronic
1107769465 13:43774760-43774782 CCTTGCAGTGAGAGCAGGGCTGG - Intronic
1113401157 13:109994560-109994582 CCTCGGAGTGAGAACTTTGCAGG - Intergenic
1113667688 13:112152375-112152397 CCCTGCAGTGGACATTTGGCTGG - Intergenic
1115041110 14:28929460-28929482 GCTTGCAGAGAGAATATGGAAGG + Intergenic
1117073239 14:52075055-52075077 CCTCACAGTGAGAAGATGGCTGG - Intergenic
1117076861 14:52113948-52113970 CAGTGCAGAGAGAATTTGGAGGG - Intergenic
1118018974 14:61691413-61691435 CTTTACAGTGAGAATCTGACAGG + Intergenic
1118273072 14:64361544-64361566 CCTTGCTTTCAGAGTTTGGCTGG + Intergenic
1121801287 14:96776193-96776215 CCTTGAAGGGAGGCTTTGGCTGG + Intergenic
1122654529 14:103248901-103248923 CCTAGGAGTGAGAATTTGCTGGG + Intergenic
1123829923 15:24124825-24124847 CCATGCAGTTAGAGTTTGTCTGG - Intergenic
1123850228 15:24347968-24347990 CCATGCAGTGAAAGTTTGTCTGG - Intergenic
1123855171 15:24402530-24402552 CCATGCAGTGAAAGTTTGTCTGG - Intergenic
1129425966 15:75463142-75463164 CCTTGAAGTGAGAATGAGGAAGG - Intergenic
1129702310 15:77774953-77774975 ACTTGCTGTGTGAATTTAGCTGG - Intronic
1130695868 15:86130890-86130912 GGTTGCAGTCAGAAGTTGGCTGG + Intergenic
1132267184 15:100484470-100484492 CCTTGCAGAGAGAATACTGCCGG - Intronic
1132584329 16:699782-699804 CCTTCCAGTGAGGCTGTGGCAGG - Intronic
1134601321 16:15536035-15536057 ATTTGCAGTGAGATTTTGGTGGG + Intronic
1135585563 16:23668263-23668285 CCTTGAGGTTAGAATTTAGCAGG + Exonic
1139503735 16:67388615-67388637 CCTTGCTGTGAAAATGGGGCTGG - Intergenic
1139566646 16:67781716-67781738 CCTTGCATTGTGGTTTTGGCAGG - Intronic
1141300284 16:82809111-82809133 CTTTGCAATGATAATTTGGCAGG - Intronic
1141954494 16:87361364-87361386 CTTCGCAGTGAGAATGTGGCAGG + Intronic
1142934546 17:3317508-3317530 CATTGGAGTGAGAAGTTGGGAGG + Intergenic
1149429928 17:56589507-56589529 CCTTGCCCAGAGAATTTTGCAGG + Intergenic
1149917338 17:60622393-60622415 CCTTTCAGTGGGATTTTGGTGGG + Intronic
1151372051 17:73653985-73654007 CATTGGAGTGATAGTTTGGCTGG + Intergenic
1151946098 17:77320756-77320778 CCTTGAAGACAGACTTTGGCTGG - Intronic
1152848067 17:82614498-82614520 CCTTGCTGTGAGAATCTGGTTGG - Intronic
1153038337 18:786178-786200 CCTCTAAATGAGAATTTGGCAGG + Intronic
1154559259 18:15804077-15804099 CCTAGCCGTGAGAATTTCGTTGG + Intergenic
1154581685 18:16111386-16111408 CCTAGCCGTGAGAATTTCGTTGG + Intergenic
1154640073 18:16911830-16911852 CCTAGCCGTGAGAATTTCGTTGG + Intergenic
1154738963 18:18267275-18267297 CCTAGCCGTGAGAATTTCGTTGG + Intergenic
1154745012 18:18350065-18350087 CCTAGCCGTGAGAATTTCGTTGG + Intergenic
1154770036 18:18693221-18693243 CCTAGCCGTGAGAATTTCGTTGG + Intergenic
1166701725 19:44886065-44886087 CCTGGCAGGGAGAAGCTGGCTGG + Intronic
926319747 2:11741128-11741150 CCTTCCAGGGAGAATTTCACAGG - Intronic
926592301 2:14752346-14752368 CCTTGCATTGAGGATATGCCAGG - Intergenic
928828762 2:35453425-35453447 CTTTGTAGTGTGAATTTGGAAGG - Intergenic
929422175 2:41803539-41803561 CCTCACAGTGAAAACTTGGCAGG + Intergenic
942381572 2:175396919-175396941 TCTTGCAGATAGATTTTGGCTGG + Intergenic
943738603 2:191386115-191386137 CCTTGCAGGGGTAACTTGGCAGG - Intronic
943782206 2:191837099-191837121 TCCTGCAGTGGGATTTTGGCAGG - Intronic
945420623 2:209631641-209631663 TATTTCAGTGAGAATTAGGCAGG - Intronic
946064003 2:216970548-216970570 TCTTGCAGTCAGATATTGGCTGG + Intergenic
946823674 2:223655239-223655261 CCTTGCTGTTAGAATTAAGCAGG - Intergenic
948227652 2:236323996-236324018 CCTTCCAGTGAGGACTAGGCGGG + Intergenic
1169006015 20:2207658-2207680 CCTTGCAGGGAGAGCTTGCCCGG - Intergenic
1169048531 20:2557761-2557783 CCTCACAGTGAAAATTTGGTAGG + Intronic
1169228653 20:3872141-3872163 ACTTAAAGTGAGATTTTGGCTGG + Exonic
1169553239 20:6722836-6722858 CCCTGAAGGGAGAATTTGGCTGG + Intergenic
1170419294 20:16176579-16176601 GCTTGCAGTTAGAAGGTGGCTGG - Intergenic
1170693225 20:18633952-18633974 CCTGGCAGTGATAAGTTGGAAGG + Intronic
1171104040 20:22415184-22415206 CCTTGAAATGAAAATTAGGCTGG + Intergenic
1171346785 20:24471168-24471190 CCTAGCACGGAGAAGTTGGCCGG - Intronic
1174213628 20:48899342-48899364 CCATGCAGTGAGAGTGTGACTGG - Intergenic
1176187385 20:63788490-63788512 CTTTGCAGTGAGTAATAGGCAGG + Intronic
1177093379 21:16799256-16799278 CCTTGCTGTGGCAATTTGGTTGG + Intergenic
1180789015 22:18564018-18564040 GCTGGCAGTGAGCATTTGGGTGG - Intergenic
1180901312 22:19375429-19375451 CCTTGAAGTGGGAAGGTGGCTGG - Intronic
1181232720 22:21431302-21431324 GCTGGCAGTGAGCATTTGGGTGG + Intronic
1181245931 22:21503554-21503576 GCTGGCAGTGAGCATTTGGGTGG - Intergenic
1185257838 22:49846048-49846070 CTTTGCTGTGGGAGTTTGGCTGG + Intergenic
949235905 3:1807840-1807862 CCTTGCAGTGCTAATCTGGTTGG - Intergenic
949587949 3:5461309-5461331 CCTTGAACTTTGAATTTGGCAGG + Intergenic
951710093 3:25578026-25578048 CCTTGCTGTGAGTATGAGGCAGG - Intronic
954939595 3:54359344-54359366 CCCTGCAGTATGAATTTGTCAGG + Intronic
956241005 3:67130579-67130601 CCTTGTATTGTGAATTTTGCAGG + Intergenic
958781643 3:98550455-98550477 CCTTGCCTGAAGAATTTGGCAGG + Intronic
960200515 3:114829753-114829775 CCATGCAGTTAGCATATGGCAGG + Intronic
962944285 3:140153374-140153396 CCTTGCAGTGAGAATTTGGCGGG + Intronic
964669035 3:159205055-159205077 CCTTGCAGAGAGACTTTGCATGG - Intronic
969320936 4:6412105-6412127 CCATTCAGTGAGGATTTGCCAGG - Intronic
969426982 4:7130210-7130232 GTTTGGAATGAGAATTTGGCAGG + Intergenic
969545683 4:7826141-7826163 CCACACAGTGAGAACTTGGCTGG - Intronic
970707341 4:18820893-18820915 CATTTCAGTGAGATTTGGGCAGG + Intergenic
976962119 4:90990538-90990560 GCTTGCAGTGAATATTTGTCAGG + Intronic
977270698 4:94914362-94914384 CCTTGAAGAGAGATTTGGGCTGG + Intronic
977679919 4:99787012-99787034 TTTTTCAGTGATAATTTGGCAGG - Intergenic
978648980 4:110977100-110977122 CCTTACATAGAGAATTTTGCTGG + Intergenic
979055923 4:115994268-115994290 CCCTGCAGAGAATATTTGGCTGG - Intergenic
980548051 4:134295562-134295584 CCATGCAGTATGATTTTGGCTGG - Intergenic
982150425 4:152449188-152449210 TCTTACTGTGAGTATTTGGCAGG - Intronic
982665846 4:158261855-158261877 CATTCCAGAGAGAATTTGGATGG - Intergenic
985296363 4:188441132-188441154 CATTGAAGTGAGAATTTTGTGGG + Intergenic
985991216 5:3563486-3563508 CCTTGCAGTGAAGCTTTGCCTGG - Intergenic
986439924 5:7771614-7771636 GCTTGCAGTGATCATATGGCAGG - Intronic
987558890 5:19492203-19492225 CCTTACAGTTAGAATTAAGCCGG + Intronic
988700393 5:33668009-33668031 GCTTGGGGTGAGAATTTGTCAGG - Intronic
990275028 5:54186303-54186325 CTTTGCAGTCAGAATCTGTCTGG - Intronic
992170225 5:74094152-74094174 CCATCCAGTAAGAATGTGGCTGG - Intergenic
993175561 5:84480927-84480949 TCTTGCAGTTAGCAATTGGCAGG - Intergenic
993354484 5:86889102-86889124 CCTTACAGTTAGAAATTTGCAGG + Intergenic
996177266 5:120374242-120374264 GTTTGCAGTGGGAATTTTGCAGG + Intergenic
997120983 5:131172531-131172553 CCTTGAAGTGGGGATTTGGTTGG + Intronic
998175727 5:139900886-139900908 CCTTGGAGTCAGATTTTTGCAGG - Intronic
999347937 5:150840814-150840836 CCTTGGAGTGAGAAATCAGCAGG + Intergenic
1002953693 6:1841392-1841414 CTTTGCAGTGAGAGTTTGGGAGG - Intronic
1006385066 6:33726303-33726325 GCCTGCAGGGAGAATTTGGAGGG + Intronic
1009909929 6:69913520-69913542 CCTTGAAGTGTGAATTTACCAGG + Intronic
1017757289 6:157540191-157540213 CCCTGCAGTGAGAGTGTGGCAGG + Intronic
1018172015 6:161151088-161151110 CCTTGCAGTTAGAATCAGGCTGG - Intronic
1021285466 7:18776236-18776258 TCTTGGAATGAGAATTTGCCAGG - Intronic
1021446140 7:20735735-20735757 CCTTGCAGTGGAAAGCTGGCTGG - Intronic
1021669729 7:23023334-23023356 CCTTCCAGTGAGATTTCTGCAGG - Intergenic
1021877448 7:25062006-25062028 CCTTACAGTTACAAATTGGCAGG + Intergenic
1026149155 7:67773384-67773406 CATTGCTGTGAGAACTTGGCAGG + Intergenic
1026430447 7:70341839-70341861 ACTTGCAGTGCAAGTTTGGCTGG + Intronic
1026842346 7:73677041-73677063 CCTTGCAGATAGTATTTGGCTGG - Intergenic
1030155176 7:106447737-106447759 CCATTCAGGCAGAATTTGGCTGG - Intergenic
1034108521 7:148513493-148513515 CATTTCAGTGAGATTTGGGCAGG + Intergenic
1034730472 7:153382704-153382726 CCTGTCAGGGAGAATTTGGGAGG - Intergenic
1035404578 7:158588758-158588780 CCTTGGAATGAGAACGTGGCAGG - Intergenic
1035744782 8:1953945-1953967 CCGTGCACTCAGATTTTGGCAGG + Intronic
1039661835 8:39476737-39476759 CATTGTAGGGAGAATTGGGCAGG - Intergenic
1039828753 8:41196052-41196074 GCCTGCAGGGAGAATTTCGCAGG + Intergenic
1040661376 8:49580089-49580111 CCTTCAAGTGAAAGTTTGGCAGG - Intergenic
1040897313 8:52382309-52382331 CCTTTCAGTGAGAATGAGGCAGG - Intronic
1041104781 8:54430762-54430784 CTTTGGATTGAGCATTTGGCAGG + Intergenic
1042415422 8:68512886-68512908 CCTTGAAGTGAGAAATTGCTAGG - Intronic
1044632352 8:94292001-94292023 CTTTTCATTGAGAAGTTGGCTGG - Intergenic
1044653346 8:94522291-94522313 TGTTGCTGTGAGAATTAGGCAGG + Intronic
1046637921 8:116693125-116693147 CCTTTCAGTGACAATAAGGCAGG + Intronic
1047236461 8:123046291-123046313 CCTTGAGGTGGGAATGTGGCTGG + Intronic
1047619935 8:126596125-126596147 GTTTGCAGTGAGATATTGGCTGG + Intergenic
1050129320 9:2394513-2394535 CCCTGAAGAGAGAATTTAGCTGG + Intergenic
1051023857 9:12581606-12581628 CCTTGGAGTGAGAAAGAGGCAGG + Intergenic
1051059872 9:13033322-13033344 CCATGAAGTGGGAATTTGGGAGG - Intergenic
1051434261 9:17014070-17014092 CCTTGCATTCAGACTTTGACTGG + Intergenic
1051528972 9:18078756-18078778 CCCTGCAGAGAGAATATGGGTGG - Intergenic
1052351224 9:27460373-27460395 ACATGCAGAGAGAATTCGGCTGG + Intronic
1056813998 9:89787311-89787333 CCTCCCAATGAGAATTTGTCAGG - Intergenic
1057311108 9:93943826-93943848 CCAGACAGTGAGAGTTTGGCCGG + Intergenic
1061423586 9:130485387-130485409 CTTTGCTGTGTGACTTTGGCCGG - Intronic
1186891086 X:13959862-13959884 ACTGGCAGTTAGAAGTTGGCTGG + Intergenic
1187973589 X:24683089-24683111 CCTCACAGTGAGAATCTGGTGGG - Intergenic
1189751029 X:44223127-44223149 CCTTGCAGTTAGAAATATGCAGG + Intronic
1189845100 X:45128668-45128690 CCTAGCAGGGAGAACTTGGGTGG + Intergenic
1191710463 X:64144743-64144765 CTTTGCAGTGAGAATTCAGTAGG - Intergenic
1199929113 X:152500469-152500491 CCTTGCTGTGAAAAGCTGGCAGG + Intergenic