ID: 962945949

View in Genome Browser
Species Human (GRCh38)
Location 3:140170873-140170895
Sequence CAGAGGATTCACATAGGACC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 137}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962945942_962945949 20 Left 962945942 3:140170830-140170852 CCATCAGCATTTTACAGTCGTGG 0: 1
1: 0
2: 3
3: 8
4: 101
Right 962945949 3:140170873-140170895 CAGAGGATTCACATAGGACCAGG 0: 1
1: 0
2: 1
3: 9
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962945949 Original CRISPR CAGAGGATTCACATAGGACC AGG Intronic
900123392 1:1059078-1059100 CAGAGGACTCAAAGGGGACCTGG + Intergenic
900858016 1:5201456-5201478 CAGAGGACCCCCATAGGCCCTGG - Intergenic
904249086 1:29209885-29209907 CAGCTGACCCACATAGGACCAGG - Intronic
905006361 1:34713259-34713281 CAGAAGATTCACATCAGACATGG + Intronic
905941440 1:41866493-41866515 CCAAGGATTCACAGTGGACCTGG + Intronic
906550140 1:46658686-46658708 CAGAGGATTCACTAAGGACAAGG - Exonic
907445684 1:54506397-54506419 CAGAGGATTCAGATGGACCCTGG - Intergenic
907605656 1:55814913-55814935 CAGAAGATTCACATAGGTTAGGG + Intergenic
909280832 1:73751036-73751058 CAGAGGAGTTACATAGGAAAAGG - Intergenic
921968279 1:221116842-221116864 CAGAGGTTTCACATAGCACCTGG - Intergenic
922417364 1:225433617-225433639 CAGAGGATTCTGATAGAAGCAGG + Intergenic
923866684 1:237947199-237947221 CAGAGGATTCAGAGGGGACCAGG + Intergenic
1064049163 10:12044889-12044911 CAGAAGAATCACTTAGAACCCGG + Intergenic
1064093216 10:12402846-12402868 CTGAGGATATACACAGGACCAGG + Intronic
1066610254 10:37238161-37238183 CTGAGCATTCACATCTGACCTGG + Intronic
1067000087 10:42602779-42602801 CACAGTACTCACATAGGGCCTGG - Intronic
1067537444 10:47124175-47124197 CAGAGGACTCCCATAGGAGCAGG + Intergenic
1068334863 10:55621550-55621572 CATTAGATTCACATAGGACCAGG + Intronic
1068925249 10:62529173-62529195 CAGAGACTTCACATAGTAGCTGG - Intronic
1074849849 10:117431004-117431026 CAGGGGAATCACTTAAGACCAGG - Intergenic
1076010288 10:126982237-126982259 CAGAGGAAGCACAGAGCACCAGG - Intronic
1076297751 10:129400357-129400379 CAAAGGATCCAAAAAGGACCTGG - Intergenic
1079166739 11:18051002-18051024 CACAGAATTAACATATGACCTGG + Intergenic
1079678948 11:23267830-23267852 CAGAGGGTACAGATAGCACCTGG + Intergenic
1088235462 11:107718530-107718552 AAGAAGATACACATAGGGCCAGG + Intronic
1088836190 11:113579617-113579639 CAGAGGCTGCACACAGGGCCCGG + Intergenic
1089401374 11:118166502-118166524 CAGTGGCTTCAGAGAGGACCTGG - Exonic
1089583734 11:119497134-119497156 CAGAGGCTTCAGATACCACCAGG - Intergenic
1090743522 11:129688878-129688900 CATAGGATTATCATATGACCTGG + Intergenic
1092514738 12:9198257-9198279 CAGGAGATTCACATAAGCCCAGG + Intronic
1094188546 12:27671976-27671998 CACAGGAATCACATAAGCCCAGG + Intronic
1102089833 12:110176451-110176473 CAGAGGCTTCACAAATGATCAGG + Intronic
1109474445 13:62860682-62860704 AAGAGGATGCATATATGACCAGG + Intergenic
1110299019 13:73903814-73903836 CACTGGATTCTCATAGGAGCGGG + Intronic
1111034082 13:82647672-82647694 CAGTAGATTCCCATAGGAGCAGG - Intergenic
1114456012 14:22853875-22853897 CAAAGGATTCTCATGGCACCAGG - Intergenic
1121725405 14:96144688-96144710 CAGATAATTAACATAGTACCTGG - Intergenic
1121733326 14:96201608-96201630 CTGCTGATTCACAGAGGACCAGG + Intergenic
1121817293 14:96938388-96938410 CAGAAGATTCTCATAGGAGCTGG + Intergenic
1121906336 14:97749785-97749807 CAGAGGATTCAAATACGGCCTGG - Exonic
1123023525 14:105412979-105413001 CAGAGGATTCAACTCGGGCCAGG - Exonic
1126661660 15:51038885-51038907 CTGAACATTCACTTAGGACCTGG - Intergenic
1130914632 15:88295227-88295249 CAGAGGATCCTCTTGGGACCTGG + Intergenic
1132619043 16:855760-855782 CAGAGGCTTCACACTGCACCAGG + Intronic
1134411050 16:14003544-14003566 CAGAGCATGCACGTAGGTCCTGG + Intergenic
1136678242 16:31935381-31935403 CAGAGGCTTCACATAGTATTTGG + Intergenic
1137361654 16:47822174-47822196 CATAGGATTTAAATAGGACTGGG + Intergenic
1137523849 16:49216547-49216569 CAGAGCATTCAGATAGTACCTGG + Intergenic
1138186521 16:54981786-54981808 CAGAGGATTCCCGCAGGACCTGG - Intergenic
1140374601 16:74434587-74434609 CTGCTGACTCACATAGGACCAGG + Intergenic
1140914874 16:79484217-79484239 CAGTGGATTCTCAGGGGACCTGG - Intergenic
1141785895 16:86200760-86200782 CAGAAGATTCACACAGCACCAGG + Intergenic
1145191694 17:20846570-20846592 CATTAGATTCTCATAGGACCAGG + Intronic
1145401904 17:22546567-22546589 CATTAGATTCTCATAGGACCAGG + Intergenic
1146411708 17:32591485-32591507 CAGAGAAATCACACAGAACCAGG - Intronic
1146422414 17:32700323-32700345 CATTGGATTCTCATAGGAGCAGG - Intronic
1148879769 17:50717005-50717027 CAGAGGTTTCAAATATGCCCTGG + Intergenic
1149388314 17:56164284-56164306 CAGAGTATTCCCAGAGGATCTGG - Intronic
1149553533 17:57557337-57557359 CACAGGAGTCACTCAGGACCTGG + Intronic
1150073184 17:62169852-62169874 CAGAAGAATCAGATAGGACGTGG + Intergenic
1150498181 17:65625333-65625355 AAGAGGAATCAGAGAGGACCAGG - Intronic
1150984710 17:70182891-70182913 CAGAGGAGACACAAATGACCTGG + Intergenic
1151029276 17:70717191-70717213 CAGAGGATTTACACAGTTCCAGG + Intergenic
1155977522 18:32146582-32146604 CAGAGGACTGAGATAGGACTTGG - Intronic
1162018882 19:7859814-7859836 CAGAGGAGCCACATGGGGCCTGG + Intronic
1162539110 19:11283053-11283075 AAGAGGTTACACATAGGGCCGGG - Intergenic
1163591484 19:18196491-18196513 CAAAAGTTTCACATAGGGCCAGG + Exonic
1165346472 19:35251618-35251640 CAGAGGACTCACAGAGGAGATGG + Intronic
1165966386 19:39584439-39584461 CAGAGAATGAACATAGGCCCAGG + Intergenic
926427865 2:12755870-12755892 CTGAGCTTTCACATAGGATCTGG + Intergenic
927368061 2:22321982-22322004 CAGAGGTTGCACACAGGATCAGG + Intergenic
929487977 2:42371879-42371901 CAGGGGATTCACCCAGGCCCAGG - Intronic
933739614 2:85523207-85523229 CACTGGATTCTCATAGGAGCTGG - Intergenic
935669026 2:105539518-105539540 CAGACGATACACAAAGGAACGGG - Intergenic
941527109 2:166619558-166619580 CAGAGGATAAAGATAGGCCCTGG - Intergenic
945918090 2:215725914-215725936 CATAGGATTCTCATAAGAGCAGG - Intergenic
948457864 2:238115281-238115303 CAGAGGATTCCCCCAGGACAAGG + Intronic
1170462876 20:16595310-16595332 CAGAGAATTAACGTATGACCTGG + Intergenic
1173732178 20:45336691-45336713 CAGCTGATTCACACAGGACAGGG + Intronic
1178004890 21:28207029-28207051 CAAAAGAATTACATAGGACCGGG - Intergenic
1179320446 21:40286173-40286195 AAGAGGATTAAGATAGGGCCAGG + Intronic
1179962225 21:44774591-44774613 GAGTGGAAACACATAGGACCAGG - Intronic
1180495324 22:15888184-15888206 CAAAGTATTTACCTAGGACCTGG + Intergenic
1181010422 22:20037101-20037123 CAGAGGAGTGACATGGGTCCAGG + Intronic
1181909178 22:26224625-26224647 CAGAGGTTTGACATAGGATTAGG + Intronic
1185232785 22:49693042-49693064 CGGGGGGTTCACAGAGGACCAGG + Intergenic
950664198 3:14485054-14485076 CATTAGATTCTCATAGGACCAGG + Exonic
951204767 3:19914585-19914607 CAGATGCTTAACATAGCACCTGG - Intronic
953915952 3:46921395-46921417 CTGAGGATCCCCAGAGGACCAGG + Intergenic
956466534 3:69525527-69525549 TTGAGGATTCACAAAGGCCCAGG + Intronic
956520649 3:70100077-70100099 CAGAGTGTTGATATAGGACCTGG - Intergenic
959102302 3:102024922-102024944 CACAGCATTCACACAGGGCCAGG + Intergenic
961203883 3:125065821-125065843 CAGAGGATGCACAGAAGGCCAGG + Intergenic
962187365 3:133274043-133274065 CCTAGGAGTCACATAGGACTGGG - Intronic
962945949 3:140170873-140170895 CAGAGGATTCACATAGGACCAGG + Intronic
963213028 3:142715352-142715374 CAGAGGACTCCCATAGGGGCTGG - Intergenic
966421859 3:179741702-179741724 TAGAGAATTAACATAAGACCTGG - Intronic
966926701 3:184648978-184649000 CAGAGGCTTCTAATAGGAGCGGG - Intronic
967333868 3:188320801-188320823 CAGAGGATGCACAGAGGATTGGG + Intronic
967358812 3:188606214-188606236 CAGAGGAGTCACGAAGGACAGGG - Intronic
970781175 4:19739906-19739928 TAGAGGATTCACAGATGTCCTGG - Intergenic
979748648 4:124248107-124248129 CTGAAGATTGATATAGGACCAGG - Intergenic
982652166 4:158099671-158099693 CAGAGAAGTGACAAAGGACCGGG - Intergenic
983472874 4:168177886-168177908 GACAGGCTTCCCATAGGACCTGG - Exonic
984966689 4:185145610-185145632 CAGGTGCTTCACATATGACCAGG - Intronic
987072561 5:14351918-14351940 CAGAGGATGCCTAGAGGACCTGG - Intronic
988521220 5:31947202-31947224 CAGAGAGTACACATAGAACCTGG - Intronic
990208491 5:53455623-53455645 CAGGGGTTTCTCTTAGGACCAGG - Intergenic
992139346 5:73780275-73780297 CACAGGAATCTCAGAGGACCAGG - Intronic
992226658 5:74625402-74625424 CAGTAGATTCTCATAGGAGCTGG + Intergenic
994204962 5:97024290-97024312 CAGAGTACTCACAAAGAACCAGG - Intronic
994267702 5:97737981-97738003 CACATGGTTCTCATAGGACCAGG - Intergenic
1001084756 5:168692596-168692618 CAAAGGATTCAGGTAAGACCTGG - Exonic
1004441494 6:15659473-15659495 CAGAGCTATCACATTGGACCTGG - Intronic
1008897260 6:56570497-56570519 CATTAGATTCTCATAGGACCAGG - Intronic
1012628086 6:101429287-101429309 GAGAGAATTTACATAGGACTAGG + Intronic
1017192077 6:151665264-151665286 CAGAGGATTCACAGGGTAACAGG + Intronic
1017713603 6:157191348-157191370 CAGAGGATTGGAAAAGGACCGGG + Intronic
1018631379 6:165825784-165825806 TTGAGGATTCACATAGGCCGTGG - Intronic
1019636985 7:2081249-2081271 CAGAGGAGTCACTTGGGGCCAGG + Intronic
1021235072 7:18132989-18133011 CAGAGGACTCAGTTAGGACAGGG - Intronic
1023057200 7:36299934-36299956 GAGAGGCTTCACAGAGGTCCCGG - Exonic
1026212652 7:68319462-68319484 CATAGTGTTTACATAGGACCTGG - Intergenic
1026641802 7:72132943-72132965 CATTGGATTCTCATAGGAGCGGG + Intronic
1027771876 7:82417289-82417311 CAGAGGATTCACAGATCTCCAGG + Intronic
1029605070 7:101593759-101593781 TAGAGGATCCACATTGGCCCTGG + Intergenic
1031833859 7:126658569-126658591 CACAGGATTCATCTTGGACCAGG - Intronic
1032748596 7:134813270-134813292 CAGAGGATTGGAATAGGAGCTGG + Intronic
1038885334 8:31656827-31656849 CATTGTATTCTCATAGGACCTGG - Intronic
1039395394 8:37221128-37221150 CAAATGATTCACATAAGGCCAGG - Intergenic
1041345242 8:56890292-56890314 CAGAGCTTTCACGTGGGACCGGG - Intergenic
1043259417 8:78178707-78178729 CAGGCGAATCACTTAGGACCAGG + Intergenic
1045187511 8:99854041-99854063 CACAGGATTCACCAAGGCCCTGG - Exonic
1048440736 8:134457481-134457503 CAGAGGCTTCACGCAGCACCTGG - Intergenic
1048465969 8:134665063-134665085 CAGAGGTTGCAGACAGGACCTGG - Intronic
1048665563 8:136657276-136657298 CAGAGGATGCACATGGTCCCTGG - Intergenic
1050051326 9:1604609-1604631 CAGAGGTTTCATATAAGACTAGG + Intergenic
1050694344 9:8262089-8262111 CCCAGGATTAACATAGGAGCAGG - Intergenic
1054563280 9:66735060-66735082 CAGAGGCTTCACACAGCATCTGG + Intergenic
1055527596 9:77151019-77151041 CAGAGCATTTACATAGGGCAGGG + Intergenic
1057398123 9:94698365-94698387 CAGAGGCTTTACATAGAACTGGG + Intergenic
1059033633 9:110729605-110729627 AAAAAAATTCACATAGGACCAGG - Intronic
1186358409 X:8811831-8811853 CAGGAGATTAACATAGAACCTGG - Intergenic
1186610304 X:11132234-11132256 CAGAGTATTCAAATAGGTGCTGG + Intergenic
1187432128 X:19234736-19234758 CAGAGCATTAACATAGGGCTTGG - Intergenic
1190690445 X:52909089-52909111 CAGAGGAGTCACATGGGTACTGG - Intergenic
1190695538 X:52946703-52946725 CAGAGGAGTCACATGGGTACTGG + Intronic
1196758157 X:119176220-119176242 TAGTGGACTTACATAGGACCAGG + Intergenic