ID: 962947876

View in Genome Browser
Species Human (GRCh38)
Location 3:140188445-140188467
Sequence CAAGGTGCAATGTAAGCATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 111}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962947876_962947881 3 Left 962947876 3:140188445-140188467 CCTGATGCTTACATTGCACCTTG 0: 1
1: 0
2: 0
3: 10
4: 111
Right 962947881 3:140188471-140188493 GGGTTAATCCCAACTCCTCGTGG 0: 1
1: 0
2: 0
3: 2
4: 53
962947876_962947886 19 Left 962947876 3:140188445-140188467 CCTGATGCTTACATTGCACCTTG 0: 1
1: 0
2: 0
3: 10
4: 111
Right 962947886 3:140188487-140188509 CTCGTGGCCCTCTGGTTACTTGG 0: 1
1: 0
2: 1
3: 7
4: 84
962947876_962947883 11 Left 962947876 3:140188445-140188467 CCTGATGCTTACATTGCACCTTG 0: 1
1: 0
2: 0
3: 10
4: 111
Right 962947883 3:140188479-140188501 CCCAACTCCTCGTGGCCCTCTGG 0: 1
1: 0
2: 0
3: 11
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962947876 Original CRISPR CAAGGTGCAATGTAAGCATC AGG (reversed) Intronic
904323204 1:29709901-29709923 AAAGGTGAAATTTCAGCATCCGG - Intergenic
906631366 1:47371143-47371165 AAAAGAGCTATGTAAGCATCTGG + Intronic
909894226 1:81046218-81046240 CAAGGTGCATCCTAAGTATCTGG + Intergenic
911023392 1:93411562-93411584 CAAGGTTCAATGTAAAAATGGGG - Intergenic
915048787 1:153044780-153044802 CAAGGAACAATTAAAGCATCTGG - Intergenic
915208846 1:154291514-154291536 CACTGTGCTATGTAAGCATAGGG + Intergenic
916001673 1:160622478-160622500 GAAGCTGCACTGGAAGCATCTGG - Intronic
916501000 1:165386852-165386874 CCAGGTCCAAGGTAAGCAGCTGG + Intergenic
916799561 1:168203690-168203712 CCAGGTGCACTGTAAGCATAAGG + Intergenic
920585264 1:207153076-207153098 GAAAGTTCCATGTAAGCATCCGG + Intergenic
920782840 1:209011476-209011498 CAAGGTGTAATGTAGACACCAGG - Intergenic
921186326 1:212672774-212672796 CAATGTGCATTGAAAGCACCCGG - Intergenic
924250064 1:242123783-242123805 AAAGGGGCAATGTAAATATCTGG - Intronic
1063451004 10:6150224-6150246 CCAGGTCCAATATAAGCATGAGG - Intronic
1063494642 10:6495529-6495551 CAAGGTGGAGAGTAAGCATGTGG - Intronic
1063857869 10:10274967-10274989 CAAGGTGTGATGAAACCATCTGG - Intergenic
1064548543 10:16475461-16475483 CGAGTTGCAATGTAAGAATCTGG - Intronic
1066094556 10:32059710-32059732 CAAGGTGGCCTGTAAGCAGCTGG - Intergenic
1067173474 10:43926147-43926169 CAAATTGCAAAGAAAGCATCTGG - Intergenic
1073416885 10:103391178-103391200 CAATGTGAAATGTAAGTTTCTGG - Intronic
1075852794 10:125602904-125602926 CCAGGTGTCATGTAATCATCAGG - Intronic
1076332868 10:129683902-129683924 CACTGTGAAATGTAAACATCAGG - Intronic
1083715454 11:64572632-64572654 CAGAGTGCAATGTAGACATCAGG - Exonic
1083739897 11:64703217-64703239 CCAGGAGCCATGTAAGCAGCTGG - Intronic
1085333416 11:75671174-75671196 CAAGGCACAAAGTAGGCATCAGG - Intergenic
1087170391 11:95043753-95043775 CAAGGTACAATGTATGCACCTGG + Intergenic
1088202276 11:107351314-107351336 CAAGGTCTAATGCAAGCAACTGG + Intronic
1091880396 12:3972614-3972636 GAAGTCGCCATGTAAGCATCTGG + Intergenic
1094185423 12:27637169-27637191 CCAATTGGAATGTAAGCATCAGG + Intronic
1097400490 12:59122771-59122793 CTAAGTGTAATGAAAGCATCGGG + Intergenic
1105301126 13:19135607-19135629 CAACTTGCAATGTAAGTCTCTGG + Intergenic
1106525951 13:30541580-30541602 CAAGGGGAAATCTCAGCATCTGG - Intronic
1106903211 13:34376891-34376913 CAAAGTGCAATGAAAACAACGGG + Intergenic
1108193369 13:47966193-47966215 CAGGGTGAAATGTAAACAACCGG + Intronic
1109728742 13:66381734-66381756 CAAGGAGAAATGAAAGAATCAGG - Intronic
1110675535 13:78239116-78239138 CAAGCTGAAATATAAGCACCAGG - Intergenic
1110927466 13:81173048-81173070 TGAGGTTCAATGTAAGAATCAGG + Intergenic
1113230563 13:108209614-108209636 CAAGGTTCAATGTATACTTCTGG + Exonic
1117211735 14:53507744-53507766 CAAGGTGCAGTGTGAGACTCTGG - Intergenic
1117420104 14:55535991-55536013 CAAGGTGCATGGTTAGCATGAGG - Intergenic
1119350525 14:73961124-73961146 CAAGGTGAAATGTGAGTAGCAGG - Intronic
1120224883 14:81779377-81779399 CAGGGAGCAATGGAAGCATATGG - Intergenic
1122918036 14:104867792-104867814 CATGGTGCAAGGACAGCATCAGG - Intronic
1127817168 15:62621143-62621165 CAAGGTGCTATATAAGAAGCAGG - Intronic
1135531459 16:23258365-23258387 CAAGGTGCAATAGCAGCAGCAGG + Intergenic
1137399186 16:48139556-48139578 CAAAGTGTAATGTTACCATCTGG + Intronic
1139292905 16:65874248-65874270 TAAGGTGCAATGCAAGGCTCTGG + Intergenic
1143331296 17:6137863-6137885 CCAGGTGCAATGTAGGAAACAGG + Intergenic
1143563153 17:7706956-7706978 CCAGCTGCAATGTGAGTATCAGG + Intronic
1147726722 17:42570162-42570184 CGAGGAGCACTGTAAGCCTCAGG + Exonic
1148092855 17:45033003-45033025 CAACCTGTAAAGTAAGCATCAGG + Intronic
1150376017 17:64682224-64682246 CAAAGTGCTCTGTAAGCAACTGG + Intergenic
1158504306 18:58032516-58032538 GAAGGTGCAATAAAAACATCAGG - Intergenic
930468496 2:51783390-51783412 CATTGTTCAATGTAAGCCTCAGG + Intergenic
931784535 2:65607542-65607564 CAAGAAGCAGTGTGAGCATCAGG - Intergenic
935872120 2:107462329-107462351 CATGGTGCAATCAAAGCATATGG + Intergenic
936283789 2:111165255-111165277 CAGGATGCACTGTCAGCATCAGG + Exonic
936382324 2:111997557-111997579 CTGGGAGCAATGTAAGCAGCTGG - Intronic
936865161 2:117069111-117069133 CTAGGGGCAATTTTAGCATCTGG + Intergenic
938978837 2:136506516-136506538 AAAGGGGCAATGTGAGCATCTGG - Intergenic
1169847971 20:10016021-10016043 CAATGTGCGATGTATGTATCTGG - Intronic
1171118349 20:22546760-22546782 CAAAGTTCAATGAAAGAATCAGG - Intergenic
1171753258 20:29076403-29076425 CATGGTGAAATGTAATCCTCAGG + Intergenic
1175406934 20:58741077-58741099 CAAGCTGCCAGGTAAGCACCTGG + Intergenic
1175564019 20:59958573-59958595 CAAGATGGGATGAAAGCATCTGG + Exonic
1178738808 21:35177352-35177374 CAAAGTGCAATGTGATCCTCTGG + Intronic
950949558 3:16983872-16983894 CAAAATGCAATGAAAGCATTAGG - Intronic
953715124 3:45311070-45311092 CCAGGTGCATTATAAGCATTTGG + Intergenic
954681885 3:52350346-52350368 CAGGGTGCAAGGGCAGCATCAGG - Intronic
955020485 3:55116254-55116276 CCAGGTGCAGAGAAAGCATCAGG - Intergenic
958137326 3:89511692-89511714 CTAAATGCAATGTAAGCATAAGG - Intergenic
960387375 3:117036332-117036354 CAAGTTGCAATCTAATCAACTGG - Intronic
962947876 3:140188445-140188467 CAAGGTGCAATGTAAGCATCAGG - Intronic
970710530 4:18856878-18856900 CAAGGTGTAAGGTAGGCATCTGG - Intergenic
972719981 4:41686613-41686635 CAAGGTCCAATGTAGGCAAGTGG - Intronic
973109988 4:46386731-46386753 CCAAGTGCAATATAAGCATCAGG + Intronic
973530947 4:51836339-51836361 CAAAGTAAAATGTAAGCATTCGG + Intergenic
975060356 4:69989411-69989433 TAAGATGCATTGTAAGCATATGG - Intergenic
982012673 4:151121824-151121846 CAAGGTGAAGGGAAAGCATCTGG - Exonic
983652711 4:170049447-170049469 CATGGTGCAAATTAAGCATTTGG - Intergenic
984075048 4:175166439-175166461 CAAGGTGCAAAGTAGGCACCAGG + Intergenic
986119395 5:4817603-4817625 CAAAGTGCAATGGAGCCATCAGG + Intergenic
987812410 5:22855044-22855066 GAATGTGCATTGGAAGCATCTGG - Intergenic
988197700 5:28027072-28027094 TAAAGTGCAAAGTAATCATCAGG + Intergenic
988376712 5:30444738-30444760 CAATGTGCAATGTTTGCAACAGG - Intergenic
988596200 5:32593636-32593658 AAAGGTGCAATGTCAGCCTTAGG - Intronic
990971506 5:61511668-61511690 CAAGGTGCAAATTTGGCATCTGG - Intronic
992920260 5:81509224-81509246 CAAGGAGGAATGGAAGCAACTGG - Intronic
993205602 5:84874396-84874418 CAAGGTAAGAAGTAAGCATCAGG - Intergenic
995025345 5:107414255-107414277 CAAGGTGGAATTTAAGTCTCAGG - Intronic
995622955 5:114047783-114047805 CAAGTAGCAATGTTAGCAGCAGG - Intergenic
997615869 5:135245891-135245913 GCAGGTTCAATGTATGCATCGGG + Intronic
1000968455 5:167687414-167687436 AAAGGTGAAATGGAAGCATTGGG + Intronic
1002823204 6:748194-748216 CAAGATGAAATGTGAACATCTGG - Intergenic
1003912446 6:10754609-10754631 CAAGGTACAATGTGTGCTTCAGG - Intronic
1004036289 6:11927447-11927469 CAACTTGCAATGTAAAAATCTGG + Intergenic
1004868748 6:19881455-19881477 CAAGGTACAATGTTACCATCTGG - Intergenic
1006515475 6:34543287-34543309 CAAGGTGCTATCCTAGCATCTGG + Intronic
1010950119 6:82026075-82026097 CATGGTGCCATGTATGCAGCAGG + Intergenic
1011669657 6:89670882-89670904 CATGGTGCACTGTGAGCAGCAGG - Intronic
1012157174 6:95833938-95833960 CAATGTGCACTGGAATCATCTGG + Intergenic
1014661468 6:124178121-124178143 AAAGGTGCCATGTAAGAAACAGG + Intronic
1016595739 6:145797777-145797799 CAAGGTAAAAGGCAAGCATCGGG - Exonic
1020713700 7:11641820-11641842 CAAGGTGCAATGAAAAGATAAGG - Intronic
1026970632 7:74465380-74465402 CAGGGTGCAGTGGAACCATCAGG + Intronic
1029225050 7:99020068-99020090 CAGGGTGAAAAGTAAGGATCTGG + Intergenic
1029991578 7:104967312-104967334 CAGGGAGCAAAGTAAGCAGCTGG + Intergenic
1032186514 7:129731340-129731362 CTAGGTGCAATGTCTTCATCAGG - Intronic
1038379618 8:27080235-27080257 CAAGGCCCAATGGAAGCATCTGG + Intergenic
1039757523 8:40539328-40539350 CAAGGAGAAATGTGAGGATCTGG - Intronic
1047802138 8:128321079-128321101 CAAGGTACAATGTCACCATGGGG - Intergenic
1047916726 8:129591829-129591851 CAAGCTGAAATGGAGGCATCAGG + Intergenic
1048628965 8:136219464-136219486 CAAAGTGCATTGTAAGGATAAGG + Intergenic
1050603365 9:7274762-7274784 CAAGGTGCAGTGGAGGCATGAGG - Intergenic
1055223914 9:73970576-73970598 CAAGGTGCAATGGAAGCACAGGG - Intergenic
1055592651 9:77833412-77833434 CAAAGTACAAAGTAAGCAACTGG + Intronic
1057098718 9:92337584-92337606 CAAGTTGAAATGTAACCATGTGG - Exonic
1061948848 9:133924682-133924704 CAAGGGGCAATGTCAGCTCCTGG + Intronic
1192411503 X:70937217-70937239 CAATGTGCAATTTCATCATCAGG + Intergenic
1194151048 X:90325528-90325550 GTAGTTCCAATGTAAGCATCTGG - Intergenic
1197698535 X:129577217-129577239 CAATGTACATTATAAGCATCTGG - Intronic
1200497417 Y:3902282-3902304 GTAGTTCCAATGTAAGCATCTGG - Intergenic