ID: 962952186

View in Genome Browser
Species Human (GRCh38)
Location 3:140229486-140229508
Sequence GAGAAAAAGGAAAAGGAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4173
Summary {0: 1, 1: 3, 2: 53, 3: 532, 4: 3584}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962952186_962952194 -6 Left 962952186 3:140229486-140229508 CCACCCTCCTTTTCCTTTTTCTC 0: 1
1: 3
2: 53
3: 532
4: 3584
Right 962952194 3:140229503-140229525 TTTCTCCATCCCAGGGCTCTGGG 0: 1
1: 0
2: 0
3: 50
4: 586
962952186_962952193 -7 Left 962952186 3:140229486-140229508 CCACCCTCCTTTTCCTTTTTCTC 0: 1
1: 3
2: 53
3: 532
4: 3584
Right 962952193 3:140229502-140229524 TTTTCTCCATCCCAGGGCTCTGG 0: 1
1: 0
2: 2
3: 26
4: 313

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962952186 Original CRISPR GAGAAAAAGGAAAAGGAGGG TGG (reversed) Intronic
Too many off-targets to display for this crispr