ID: 962953935

View in Genome Browser
Species Human (GRCh38)
Location 3:140247078-140247100
Sequence GGATGAACACCATTGAGAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 141}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962953931_962953935 13 Left 962953931 3:140247042-140247064 CCCTGATGGGTTTATGAAGTCTC 0: 1
1: 0
2: 0
3: 5
4: 99
Right 962953935 3:140247078-140247100 GGATGAACACCATTGAGAGATGG 0: 1
1: 0
2: 0
3: 10
4: 141
962953934_962953935 -9 Left 962953934 3:140247064-140247086 CCTCTTCTAATTAAGGATGAACA 0: 1
1: 0
2: 2
3: 17
4: 185
Right 962953935 3:140247078-140247100 GGATGAACACCATTGAGAGATGG 0: 1
1: 0
2: 0
3: 10
4: 141
962953932_962953935 12 Left 962953932 3:140247043-140247065 CCTGATGGGTTTATGAAGTCTCC 0: 1
1: 0
2: 0
3: 14
4: 160
Right 962953935 3:140247078-140247100 GGATGAACACCATTGAGAGATGG 0: 1
1: 0
2: 0
3: 10
4: 141
962953930_962953935 16 Left 962953930 3:140247039-140247061 CCACCCTGATGGGTTTATGAAGT 0: 1
1: 0
2: 0
3: 9
4: 110
Right 962953935 3:140247078-140247100 GGATGAACACCATTGAGAGATGG 0: 1
1: 0
2: 0
3: 10
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962953935 Original CRISPR GGATGAACACCATTGAGAGA TGG Intronic