ID: 962953935

View in Genome Browser
Species Human (GRCh38)
Location 3:140247078-140247100
Sequence GGATGAACACCATTGAGAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 141}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962953932_962953935 12 Left 962953932 3:140247043-140247065 CCTGATGGGTTTATGAAGTCTCC 0: 1
1: 0
2: 0
3: 14
4: 160
Right 962953935 3:140247078-140247100 GGATGAACACCATTGAGAGATGG 0: 1
1: 0
2: 0
3: 10
4: 141
962953931_962953935 13 Left 962953931 3:140247042-140247064 CCCTGATGGGTTTATGAAGTCTC 0: 1
1: 0
2: 0
3: 5
4: 99
Right 962953935 3:140247078-140247100 GGATGAACACCATTGAGAGATGG 0: 1
1: 0
2: 0
3: 10
4: 141
962953930_962953935 16 Left 962953930 3:140247039-140247061 CCACCCTGATGGGTTTATGAAGT 0: 1
1: 0
2: 0
3: 9
4: 110
Right 962953935 3:140247078-140247100 GGATGAACACCATTGAGAGATGG 0: 1
1: 0
2: 0
3: 10
4: 141
962953934_962953935 -9 Left 962953934 3:140247064-140247086 CCTCTTCTAATTAAGGATGAACA 0: 1
1: 0
2: 2
3: 17
4: 185
Right 962953935 3:140247078-140247100 GGATGAACACCATTGAGAGATGG 0: 1
1: 0
2: 0
3: 10
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962953935 Original CRISPR GGATGAACACCATTGAGAGA TGG Intronic
900588753 1:3449136-3449158 GGCTGAAAACCAGTGACAGAGGG - Intergenic
901097205 1:6691564-6691586 GGATGAACACGAATGACAGAAGG - Intronic
901811885 1:11772068-11772090 GGAAGAACACTAAGGAGAGAGGG - Exonic
901827008 1:11868742-11868764 GGATGAATATCCTTGATAGATGG + Intergenic
902267664 1:15279814-15279836 GGATGAGCCCCATTGTGGGAGGG + Intronic
909036336 1:70598034-70598056 GGATCAACAAAATTGATAGATGG - Intergenic
909439389 1:75680838-75680860 GGATCAACAAAATTGATAGACGG + Intergenic
910069940 1:83200822-83200844 TGAAGAACACCATTCAAAGATGG - Intergenic
913574971 1:120163249-120163271 TGATGAACAGCATGGAAAGAAGG - Exonic
914296235 1:146328090-146328112 TGATGAACAGCATGGAAAGAAGG - Intergenic
914557277 1:148778880-148778902 TGATGAACAGCATGGAAAGAAGG - Intergenic
914615557 1:149351350-149351372 TGATGAACAGCATGGAAAGAAGG + Intergenic
915642530 1:157240150-157240172 GAAGGAACAGCATGGAGAGAAGG - Intergenic
916175397 1:162033811-162033833 GCAGCAACACGATTGAGAGAGGG + Intergenic
916566863 1:165988116-165988138 GAATAAATACCATTGAGAGGAGG + Intergenic
920438661 1:205964202-205964224 GGAAGAACAGCATTGAAAGACGG - Intergenic
920591351 1:207221808-207221830 GCATGAAAACTATTGAGGGATGG + Intergenic
920931880 1:210396244-210396266 GAATAAAGACCATTGAGTGAGGG + Intronic
922558337 1:226549441-226549463 GGATGCACACGACGGAGAGAAGG - Intronic
922712060 1:227841761-227841783 GGATGCACACATTTGTGAGATGG - Intronic
1067982211 10:51099230-51099252 GGAAGAACACCCTGGAGTGAGGG + Intronic
1074904925 10:117853123-117853145 GGTTGAGCCCCATGGAGAGATGG + Intergenic
1075925944 10:126251974-126251996 GGATGAACAGGATTGATGGATGG + Intronic
1079172890 11:18112937-18112959 GGATGAACAGCACCCAGAGAGGG + Intronic
1079190007 11:18269520-18269542 GGATGAACAGCACCCAGAGAGGG - Intronic
1080284779 11:30597588-30597610 GTCTGTACACCATTGAGAGGTGG + Intergenic
1080839481 11:35970983-35971005 GGCTGAGCACCAGGGAGAGATGG - Intronic
1081819160 11:45974810-45974832 GTATGATCACCTTTAAGAGAAGG + Intronic
1083493817 11:63033207-63033229 GGAAGAACACCATATGGAGATGG - Intergenic
1083494126 11:63035470-63035492 GAATGTACACCTTTGAGAGAAGG + Intergenic
1085310675 11:75514808-75514830 GCATGAACAGCATACAGAGAAGG + Intronic
1089539704 11:119182393-119182415 GGAGGAGCACAGTTGAGAGAGGG - Intronic
1090068478 11:123524216-123524238 GGATAAGCACCATGGAGACAAGG - Intergenic
1091940858 12:4480186-4480208 GGATGAACACAACTGAGTGTGGG - Intergenic
1093401396 12:18751337-18751359 AGATGGACAGCATTGACAGAGGG - Intergenic
1093742519 12:22704816-22704838 CGATGAACAGCATAGAGGGATGG - Intergenic
1094729869 12:33162352-33162374 AGAGGAACACTTTTGAGAGAGGG + Intergenic
1095049260 12:37542283-37542305 GGGTGAAAACCATTGACAGCCGG - Intergenic
1097382702 12:58914414-58914436 CTATGAACACCAGTGAGAGCAGG + Intronic
1099269557 12:80490525-80490547 GGTTGAGCACCATTGAGTTAGGG - Intronic
1101488831 12:105193296-105193318 CCATCAACACCCTTGAGAGATGG + Intronic
1107370630 13:39743330-39743352 GGATCAACAAAATTGATAGACGG + Intronic
1109277444 13:60318301-60318323 GGAGAATCACCATGGAGAGAAGG + Intergenic
1110789227 13:79569007-79569029 GGATGAACACCACTGACCAAAGG - Intergenic
1111717520 13:91897787-91897809 AGATAAACACCAATGAGAGTGGG - Intronic
1112162726 13:96885791-96885813 GGAAGTACACCATGGAGAGGAGG - Intergenic
1116024993 14:39504389-39504411 GGATAAACAAGATTGATAGATGG - Intergenic
1116292126 14:43057449-43057471 GAATGAAAACCATTCAGAGGGGG + Intergenic
1117292282 14:54345246-54345268 GGATGAATACAATCCAGAGACGG + Intergenic
1119514948 14:75240679-75240701 GGCTGATCACCATGGTGAGATGG - Intronic
1124557053 15:30736033-30736055 GGAAAAACACCACAGAGAGAAGG + Intronic
1128468808 15:67934806-67934828 GGGTGAACACACTTCAGAGATGG + Intergenic
1132210367 15:100017429-100017451 GGCTGAACACCACAGGGAGAAGG - Intronic
1132824351 16:1895960-1895982 GGAGGGAAACCATTGAGAGCAGG - Intergenic
1134057637 16:11180496-11180518 GGAAGACCATCATGGAGAGAAGG + Exonic
1134212772 16:12291728-12291750 GGAAGAGCTCCATTGAGACATGG + Intronic
1136709530 16:32224662-32224684 AAATAAACACCAATGAGAGAGGG + Intergenic
1136758379 16:32704759-32704781 AAATAAACACCAATGAGAGAGGG - Intergenic
1136809729 16:33165620-33165642 AAATAAACACCAATGAGAGAGGG + Intergenic
1136816205 16:33275700-33275722 AAATAAACACCAATGAGAGAGGG + Intronic
1138770341 16:59655294-59655316 GCAAGAACACAATTTAGAGAGGG - Intergenic
1141036680 16:80632783-80632805 GGATGAAGACCATGGGGAGAGGG - Intronic
1203060530 16_KI270728v1_random:965088-965110 AAATAAACACCAATGAGAGAGGG - Intergenic
1142645211 17:1307283-1307305 TGATAAACACCATTAAAAGAAGG + Intergenic
1143547493 17:7606671-7606693 TGATGAACACAATTTACAGAAGG + Intronic
1144044945 17:11446986-11447008 GGAGGAAAACCACAGAGAGAAGG - Intronic
1147052724 17:37808401-37808423 GGCTGAACAGAACTGAGAGAGGG - Intergenic
1153590751 18:6672112-6672134 GAATGAACACAGTTGACAGATGG - Intergenic
1156116236 18:33790099-33790121 GGATCAACAAAATTGATAGATGG + Intergenic
1158048469 18:53186518-53186540 TGATGAACACCACTGAGAAAGGG + Intronic
1166462471 19:43001256-43001278 GGATGAAGACAATTCAGAAAAGG - Intronic
926471024 2:13258166-13258188 TGATGAATACCTTTGAGAAAGGG - Intergenic
929272483 2:39987753-39987775 GGATCAACAAAATTGATAGACGG + Intergenic
929552176 2:42901469-42901491 GAAGCAACACCACTGAGAGAAGG - Intergenic
932450054 2:71803802-71803824 GATTCAACACCATTGGGAGATGG + Intergenic
938631645 2:133173937-133173959 GGATAAACAGAATGGAGAGAAGG + Intronic
939812385 2:146850296-146850318 AAATGAACACGATTTAGAGATGG + Intergenic
944361744 2:198865236-198865258 TCATGAACAACATTGAAAGAAGG - Intergenic
945061956 2:205917006-205917028 GAATGTACACCACCGAGAGAGGG + Intergenic
1169716651 20:8626799-8626821 TTTTGAACACCATTGAGACAAGG - Intronic
1170141186 20:13126437-13126459 TGATGAAAACCATTGAAAGTTGG + Intronic
1172524890 20:35594337-35594359 GGATATACACCATTGATAAAAGG + Intergenic
1177270620 21:18844712-18844734 GGATCAACACCAGTGAGGGAAGG - Intergenic
1177594878 21:23225683-23225705 GTATGAACACCTTTTAAAGATGG + Intergenic
1181386178 22:22547423-22547445 TAATGAACACCACTGAGTGAAGG - Intergenic
1183499695 22:38171241-38171263 AGATAGACATCATTGAGAGATGG - Intronic
953120121 3:40031903-40031925 GGATCAACAAAATTGATAGACGG - Intronic
957251176 3:77772820-77772842 GTATGAATACCATTGGGAGCTGG - Intergenic
957873672 3:86117257-86117279 AGAAGAAAACCATTGAGAGAAGG - Intergenic
959572807 3:107903242-107903264 GGATAAACAAGATTGATAGATGG + Intergenic
960047325 3:113211139-113211161 AGAAGAAGACCATTGAGAGGTGG + Intronic
960762926 3:121093687-121093709 GGATCAACAAAATTGATAGACGG - Intronic
960963550 3:123089377-123089399 GGATGAAAACCACTTAGGGAGGG + Intronic
962580235 3:136791417-136791439 GGCTGAGCACCAAAGAGAGATGG + Intergenic
962839044 3:139217219-139217241 GGAGGAACAGCATTGAGTAAAGG + Intronic
962953935 3:140247078-140247100 GGATGAACACCATTGAGAGATGG + Intronic
963042839 3:141081961-141081983 GGCTGTAGACCATTTAGAGAAGG + Intronic
964188924 3:153980007-153980029 GGGTGAACACCACAGGGAGAAGG + Intergenic
964336494 3:155660180-155660202 GGCTGAACACAATTGAAAGTCGG + Intronic
967898141 3:194417488-194417510 TGATGAACAACAATGTGAGAGGG + Intronic
970968165 4:21950729-21950751 GGCTGAAGTACATTGAGAGAAGG + Intergenic
972142124 4:35973826-35973848 AGATGATCAACATTGAGAAAAGG - Intronic
979961248 4:127023656-127023678 GGATCAACAAAATTGATAGACGG + Intergenic
980874511 4:138647672-138647694 GGCTGAACACCACTGGGAGGTGG - Intergenic
983612589 4:169665883-169665905 GGATAAACCCCTTTGAGAAAAGG + Intronic
985656441 5:1133954-1133976 GCACGTACACCATGGAGAGAGGG + Intergenic
986050599 5:4086481-4086503 GGATCAACAAGATTGAAAGATGG - Intergenic
986398139 5:7351081-7351103 GTGTGAAAACAATTGAGAGAAGG - Intergenic
990495421 5:56343052-56343074 GGAAGAACCCCAATGGGAGAGGG - Intergenic
991911163 5:71562646-71562668 GGAGGAACACGATGGAGAGAAGG - Intronic
992400920 5:76410573-76410595 GGATGAACAGCTTTGCCAGAGGG + Intronic
992675147 5:79098806-79098828 GGATCAACAAAATTGATAGACGG - Intronic
1001387532 5:171352392-171352414 GAATGAACATCATGTAGAGATGG - Intergenic
1007099000 6:39231635-39231657 GGGTGAACTCCATCCAGAGAGGG - Intergenic
1007266657 6:40601378-40601400 GGATGAACAATATTGAGAATGGG - Intergenic
1010642941 6:78353235-78353257 GGATGAACACTCTTGACAGCTGG + Intergenic
1013720243 6:113017048-113017070 AGATGAATAACAATGAGAGATGG - Intergenic
1016065836 6:139682680-139682702 GCATGAACACTTATGAGAGAAGG + Intergenic
1019143117 6:169960755-169960777 GGATGACCTCCCTTCAGAGAAGG + Intergenic
1021374824 7:19893711-19893733 TGATAAACACCATGAAGAGAAGG - Intergenic
1021539087 7:21737034-21737056 GCATGAATACGATTTAGAGATGG + Intronic
1022073431 7:26940839-26940861 TGACGAACAACAATGAGAGAAGG + Intronic
1024618982 7:51141160-51141182 GGATGGACACCTTTGAGAAATGG - Intronic
1025996078 7:66528318-66528340 GGCTGAACACCATTGGTAGCTGG + Intergenic
1026171208 7:67955379-67955401 GGAGGAAGCCCATTGAGAGCTGG + Intergenic
1027287712 7:76665981-76666003 TGAAGAACACCATTCAAAGATGG - Intergenic
1028144922 7:87310959-87310981 GGATTAACACCATGGAAACAGGG + Intergenic
1029321487 7:99764767-99764789 GGATGTACAAGAATGAGAGATGG + Intronic
1029446383 7:100615153-100615175 GGAGGAACACCATGGTGAGGAGG - Exonic
1030209254 7:106980242-106980264 GGCTGCAAACCATTGAGAGAGGG + Intergenic
1033052902 7:138022472-138022494 GGAGGAACATCATTTAAAGATGG - Intronic
1035373139 7:158391919-158391941 GAATGAGCACCTTTGAGACAGGG + Intronic
1037032289 8:14123743-14123765 GGATGGAGACCATTGAGGGCAGG - Intronic
1038228274 8:25676642-25676664 GGATGAGCATCATGTAGAGAAGG + Intergenic
1038715369 8:29986512-29986534 GGAGGAACTGCATTCAGAGATGG - Intergenic
1040635746 8:49270854-49270876 GGGAGAACACCATGGAAAGAAGG - Intergenic
1042307330 8:67345114-67345136 GGATCAACACCTGTGAAAGAAGG - Intergenic
1043526241 8:81099371-81099393 GGGTGACCACCATTGAAACAGGG + Intronic
1043994674 8:86798291-86798313 TGATGTACACCATGGAGATAAGG - Intergenic
1046453791 8:114431828-114431850 GGATAAACATCATTTAGAAATGG - Intergenic
1046795123 8:118363357-118363379 GGATGAAGACCATTGACATGGGG - Intronic
1047838223 8:128717447-128717469 GGATCAACAAAATTGATAGACGG + Intergenic
1047938877 8:129808186-129808208 TGATGCACACCATGGAGTGAAGG + Intergenic
1049021499 8:139960474-139960496 GGATGAATGACATTGAGAGGCGG - Intronic
1050555042 9:6782463-6782485 ATAAGAACTCCATTGAGAGAGGG - Intronic
1055596251 9:77867765-77867787 GGTTGCACACCATTAAGAGCTGG + Intronic
1061335360 9:129930386-129930408 GCATGAACCCCATTGAGAACTGG - Intronic
1185917167 X:4048198-4048220 GGAAAAACACCAGTGATAGAGGG + Intergenic
1186743403 X:12541316-12541338 AGATCAACACAATTGATAGACGG + Intronic
1198439990 X:136653748-136653770 ACATCAACACCATTGGGAGATGG + Intronic
1198843463 X:140883552-140883574 GGAAGAACACCATGGGAAGATGG - Intergenic
1199898992 X:152154426-152154448 GGCTCAATACCATGGAGAGAGGG - Intergenic