ID: 962958409

View in Genome Browser
Species Human (GRCh38)
Location 3:140287576-140287598
Sequence TGGTATTCCATTACATTAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 155}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962958409_962958414 30 Left 962958409 3:140287576-140287598 CCAGTTAATGTAATGGAATACCA 0: 1
1: 0
2: 1
3: 14
4: 155
Right 962958414 3:140287629-140287651 GTTTTTTTTCCTAAGGAAAATGG 0: 1
1: 2
2: 15
3: 112
4: 1011
962958409_962958413 23 Left 962958409 3:140287576-140287598 CCAGTTAATGTAATGGAATACCA 0: 1
1: 0
2: 1
3: 14
4: 155
Right 962958413 3:140287622-140287644 AAACATAGTTTTTTTTCCTAAGG 0: 1
1: 0
2: 2
3: 56
4: 779

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962958409 Original CRISPR TGGTATTCCATTACATTAAC TGG (reversed) Intronic
906443889 1:45876495-45876517 TGGTAATACATTACAATATCAGG - Intronic
906815854 1:48877725-48877747 TGGTATTTCACTACATGAACTGG - Intronic
906829120 1:49013141-49013163 AGGTATTCAATTACAGCAACAGG + Intronic
909780821 1:79544512-79544534 TGGTTTTGCAATACATTTACTGG + Intergenic
910529429 1:88218712-88218734 TAGTATTCGATTAAATAAACAGG - Intergenic
910903428 1:92147662-92147684 TGGTATTCTTTTATTTTAACAGG + Exonic
916310627 1:163394964-163394986 TGGTATTTCATCATATTTACAGG - Intergenic
917988375 1:180346437-180346459 TGGTTTCCCATCACATTCACTGG - Intronic
918351924 1:183665169-183665191 ATGTAATCCATCACATTAACAGG - Intronic
919156450 1:193772029-193772051 TGGTATTCCATTGCATTCTGTGG + Intergenic
921735453 1:218622922-218622944 AGCTATTCAATTAGATTAACAGG + Intergenic
922980027 1:229817914-229817936 TGGTATTCCATTAAATAACTAGG + Intergenic
924617190 1:245621987-245622009 TTTTATTCCATTACATCAAATGG + Intronic
924766491 1:247036105-247036127 TGATAGTCTATTACGTTAACTGG - Intergenic
1063323749 10:5076476-5076498 AGGTATTCCATTATATTAGCAGG + Intronic
1065064285 10:21944262-21944284 TATTATTCTATTACATTTACTGG - Intronic
1065087341 10:22192263-22192285 TTTAATTCCATTATATTAACTGG + Intergenic
1067151048 10:43734884-43734906 TGGTGTTCCCTTACATTTTCTGG - Intergenic
1067857980 10:49813642-49813664 ATGTAATCCATTACATCAACAGG - Intergenic
1068025249 10:51634724-51634746 TAGTATTCCATGAAATTACCAGG - Intronic
1068799133 10:61119834-61119856 TGATATCTCATTACATTCACAGG + Intergenic
1068853994 10:61778153-61778175 TTGTATTCTGTTTCATTAACTGG - Intergenic
1069272553 10:66547710-66547732 TGGTATTGCATTAAATTTATAGG + Intronic
1069667961 10:70176588-70176610 TGGAATTCCATTACTATTACAGG - Intergenic
1071123240 10:82304831-82304853 TGACATTCCATCATATTAACAGG + Intronic
1074370389 10:112895959-112895981 TGCTGATCCATTACATGAACTGG + Intergenic
1075278138 10:121113614-121113636 TTGTATTCCATTTGATTAAAAGG - Intergenic
1077729608 11:4715821-4715843 TGATATCCCATCACATTCACAGG - Intronic
1081490189 11:43561815-43561837 TGGTCTTCCAGTCCACTAACTGG - Intronic
1084917728 11:72442039-72442061 TGATATCCCATCACATTCACAGG + Intergenic
1085949802 11:81316675-81316697 TGCTAATCTATTACATTAACTGG - Intergenic
1086739802 11:90352911-90352933 TGCTATTGCCTTAGATTAACTGG + Intergenic
1088982134 11:114873415-114873437 TAGTATTCCATTATATTGCCGGG - Intergenic
1089133795 11:116233471-116233493 TGGAATTCCATTACCTTCCCTGG - Intergenic
1090120495 11:124022268-124022290 TGATATCCCATCATATTAACAGG - Intergenic
1090121069 11:124028921-124028943 TGATATTCCATCATATTAACAGG - Intergenic
1094449470 12:30569245-30569267 TCTTATTCTATTACATTAAGAGG - Intergenic
1094707384 12:32927391-32927413 TTGTATTCCATTGCCATAACCGG - Intergenic
1098931477 12:76419963-76419985 TAATATTCCATTGCATTAGCAGG - Intronic
1104088690 12:125496255-125496277 TGGCATTCCAGTACATTTTCTGG + Intronic
1104347952 12:128019728-128019750 TAGTATTCCTTTGCATGAACAGG - Intergenic
1107110038 13:36687453-36687475 TGATCTTGCATTACATTAAGGGG + Intronic
1108056690 13:46492230-46492252 TAGGTTTCCATTACATTAAGGGG + Intergenic
1108427312 13:50316318-50316340 ATGTAATCAATTACATTAACAGG + Intronic
1112535494 13:100250337-100250359 ATGTAATCCATCACATTAACAGG - Intronic
1116421514 14:44738039-44738061 TGGGACTCCATTAAAGTAACAGG - Intergenic
1117516639 14:56508467-56508489 TATTATTCCATTACATAAATGGG + Intronic
1117946513 14:61029768-61029790 TTTTATTCCATTTTATTAACAGG - Intronic
1120711104 14:87793805-87793827 TGGTAATCCATTGTCTTAACGGG - Intergenic
1121476097 14:94204909-94204931 ATGTACTCCATCACATTAACAGG - Intronic
1122360523 14:101158788-101158810 ATGTAATCCATCACATTAACAGG - Intergenic
1124122605 15:26902920-26902942 ATGTAATCCATTACATCAACAGG - Intronic
1138756701 16:59495014-59495036 TGGTATTCCATTACATCAGTGGG + Intergenic
1140213434 16:72988594-72988616 TGGAATTCAATTGCACTAACTGG + Intronic
1147354240 17:39880779-39880801 ATGTAATCCATAACATTAACAGG - Intergenic
1151038822 17:70833863-70833885 TGTTATTTAATTACATTACCTGG + Intergenic
1155966608 18:32041545-32041567 TTGCATGCCATTACATAAACAGG - Intronic
1159572169 18:70128514-70128536 TGGTGTCCAATTACATGAACAGG + Exonic
1159674735 18:71268202-71268224 TGGGATTCCATTAAGTTAAATGG + Intergenic
1164045885 19:21541223-21541245 GGGCATTCCATTTTATTAACTGG + Intronic
1168470458 19:56636489-56636511 TGGTAATTCATTAAATTAAAAGG - Intergenic
926757423 2:16247337-16247359 AGGGATTCCATAAAATTAACTGG + Intergenic
930432183 2:51292510-51292532 TGGAAATCCATTACATTCAATGG - Intergenic
931900192 2:66779915-66779937 GGGTATTCCATTATAGCAACAGG - Intergenic
932003989 2:67909651-67909673 TGTTATTCCATTCCAGTCACAGG - Intergenic
932128780 2:69168900-69168922 TGGTATTCCATTAATTGAAGAGG - Intronic
934207020 2:89939389-89939411 TGGTATTCTATTATTTTAAATGG + Intergenic
935491882 2:103731692-103731714 CGGTATTACATTACAATAATGGG - Intergenic
937168311 2:119843104-119843126 TGGTAATCCACTATAGTAACAGG - Intronic
937383256 2:121401327-121401349 TGGTATTTCATTTCATGGACTGG + Intronic
942427028 2:175870981-175871003 TAGAATTTCATTACATCAACCGG + Intergenic
942829370 2:180221523-180221545 CAGTATCTCATTACATTAACTGG - Intergenic
942961719 2:181837453-181837475 TTCTATGCCATTACATTAAATGG + Intergenic
943301353 2:186206598-186206620 AGATATTCCCTTACTTTAACTGG + Intergenic
946069234 2:217017147-217017169 TGGTATGCCATTGCTTTTACTGG + Intergenic
948060398 2:235039254-235039276 TTCTATTCATTTACATTAACTGG - Intronic
1169053923 20:2604296-2604318 TGGTATTTCCTGAAATTAACTGG - Intronic
1170054824 20:12190144-12190166 ATGTAATCCATTACATCAACAGG - Intergenic
1172257804 20:33535313-33535335 TGGGATTCCCTTACAAAAACTGG + Intronic
1172607839 20:36226910-36226932 TGGTTTTTCCTTACAGTAACAGG - Intronic
1174890915 20:54391512-54391534 TAGTATTCCATTATATGAATTGG + Intergenic
1175646210 20:60674258-60674280 TGTTATTCCACTAAATTATCAGG - Intergenic
951871259 3:27365040-27365062 TAGTACTGCATTAGATTAACAGG - Intronic
953192819 3:40704434-40704456 ATGTAATCCATTACATCAACAGG - Intergenic
953288061 3:41632380-41632402 TTGTATTCCATTAAGTTATCCGG - Intronic
953810262 3:46106581-46106603 AGGTATTCCTGTACTTTAACTGG - Intergenic
954829938 3:53412021-53412043 TGGTATTAAATTTCATTTACTGG + Intergenic
957779451 3:84799576-84799598 TGTGATTGCATTACATTAAATGG + Intergenic
958041820 3:88235044-88235066 TGGGATTCCATTATATTAAATGG + Intergenic
958524129 3:95231167-95231189 TTGTATTCCATTATTTTAAGTGG + Intergenic
959243182 3:103826602-103826624 TTGTAATCTATTACATTAATAGG + Intergenic
959245111 3:103856373-103856395 ATGTAATCCATTACAGTAACTGG + Intergenic
959623873 3:108427565-108427587 TGGTATTTCATTACAGCAGCAGG + Intronic
959768884 3:110068950-110068972 TGGTATCCCATTGCTTTGACTGG - Intergenic
960239753 3:115326459-115326481 TGATATTCCATTATATTGACAGG + Intergenic
961095682 3:124154288-124154310 GGGTATTCAATTACAAAAACAGG + Intronic
961471731 3:127118131-127118153 TAGTATTCCATTGAATAAACAGG + Intergenic
962111563 3:132455619-132455641 TAGTATTCCATTGTATGAACAGG - Intronic
962958409 3:140287576-140287598 TGGTATTCCATTACATTAACTGG - Intronic
963232183 3:142919394-142919416 TTGTAATCCATCACATCAACAGG - Intergenic
969778726 4:9379976-9379998 TGGTATTTCATGACTTTAAGTGG - Intergenic
970856169 4:20651341-20651363 TGGTATTTCATTACATAACCTGG + Intergenic
971519973 4:27537192-27537214 TGCTATTCCATTACAATATGTGG - Intergenic
973904501 4:55514686-55514708 AATTAATCCATTACATTAACTGG - Intronic
974734385 4:65910975-65910997 AGGTATTCCATTACAGCAACAGG - Intergenic
977375044 4:96191803-96191825 ATGTAATCCATTACATTAATAGG - Intergenic
978097270 4:104793285-104793307 TGGTTTTCCATTTCCTTAAAGGG - Intergenic
984336281 4:178395720-178395742 TGATATTCTATTATATTCACAGG - Intergenic
987501127 5:18710543-18710565 TGATATTCCATTATATTTACAGG - Intergenic
989993618 5:50799999-50800021 TGGTATTCGATTACAGCAGCCGG + Intronic
990642908 5:57807941-57807963 TGGTATTCCATTATGTGAAGGGG + Intergenic
991629488 5:68641533-68641555 ATGTAATCCATTACATCAACAGG - Intergenic
993640245 5:90394334-90394356 TAGTATTCTATAATATTAACTGG + Intronic
996361579 5:122653617-122653639 TTACATTACATTACATTAACTGG + Intergenic
1002788424 6:421300-421322 TGGTATTCCATTATAGCAACAGG - Intergenic
1002993767 6:2263601-2263623 AGGTAGTCCATCACATCAACTGG - Intergenic
1006828597 6:36955083-36955105 TGGTATTACATTACTTTAAATGG + Intronic
1006884206 6:37366934-37366956 TGATATTCCTTTGCATTTACAGG + Intronic
1008343824 6:50401570-50401592 TATTCTTCCATTTCATTAACAGG + Intergenic
1009456432 6:63861922-63861944 TGGTATTCCATTACAGCAGCTGG + Intronic
1010432026 6:75788577-75788599 TGGTATTACATTACATGAATCGG - Intronic
1012119643 6:95349302-95349324 TGGTATTTGAACACATTAACAGG - Intergenic
1012983360 6:105852753-105852775 TGGGATTCCCTTACAAAAACTGG + Intergenic
1013589882 6:111611014-111611036 TGGTATTCTGTTACAGTAGCCGG - Intergenic
1014114502 6:117657050-117657072 TGGAATTTCATTACATTTCCAGG - Intergenic
1015069073 6:129067613-129067635 TGGTTTTCCATCACATTCAGTGG + Intronic
1016190995 6:141264068-141264090 TTGCATTCTATAACATTAACAGG - Intergenic
1016377607 6:143439477-143439499 TAGTATTCCATTATATGAATAGG - Intronic
1017139096 6:151174525-151174547 TGTTATTGCATTACATTACAGGG + Intergenic
1017397278 6:154016982-154017004 TTGTATTTGATTACATAAACAGG - Intronic
1017679670 6:156850880-156850902 TCATATTCCTTTACATTATCTGG - Intronic
1020985812 7:15133046-15133068 TGGTAAGCAATTACATTTACTGG + Intergenic
1021838307 7:24702438-24702460 TGGTGTTACATTACAATAAAGGG - Intronic
1023979390 7:45058755-45058777 TTGTAATCCATCACATCAACTGG - Intronic
1024191561 7:47016768-47016790 TGGGATTTCATTATATTAGCTGG - Intergenic
1030646313 7:112065460-112065482 TGTTATTCCATTATCTTACCTGG + Intronic
1031211231 7:118829264-118829286 TGATATTACATTTGATTAACTGG - Intergenic
1033994200 7:147325381-147325403 TGGCATTCCAAAACATTAAATGG - Intronic
1035555942 8:567259-567281 TGTTATTACATGACATTAAATGG - Intergenic
1035845649 8:2861558-2861580 CGGAATTCCCTTGCATTAACAGG - Intergenic
1038683750 8:29695811-29695833 TGGTATTCTATTATACCAACAGG - Intergenic
1042358830 8:67859430-67859452 TTGTATTCAATGACATGAACAGG - Intergenic
1044787745 8:95813333-95813355 TGGTGTTTGATTACATTAGCAGG + Intergenic
1045118517 8:99010785-99010807 TTGTAATCAATCACATTAACAGG + Intergenic
1045223359 8:100220559-100220581 TTTTATTCCATTACATCAAATGG + Intronic
1045224388 8:100230305-100230327 TTGTATCCCATTTCATTGACTGG + Intronic
1046793107 8:118342821-118342843 TGGTATTCAATTACATCAACAGG + Intronic
1049046097 8:140152711-140152733 TGGTATGTCTTTACATTAATAGG + Intronic
1056130453 9:83581223-83581245 TGGTATACAATTTCCTTAACGGG - Intergenic
1056960907 9:91122155-91122177 TGGTATTCTGTTACAGCAACAGG - Intergenic
1057020737 9:91695683-91695705 GAGTATTCCATTCCATTGACTGG + Intronic
1057058620 9:91983297-91983319 TGGAACTCCATTCCCTTAACTGG + Intergenic
1057325544 9:94060506-94060528 TGGTATTCCTTTATAGCAACGGG - Intronic
1059509610 9:114832236-114832258 TGGAATTACATTAAATTAAAAGG - Intergenic
1061124460 9:128665511-128665533 TGTAATTCCAGTACATTAAGAGG + Intergenic
1186063894 X:5740848-5740870 TGATATTTCATGACATTAAATGG - Intergenic
1186300621 X:8196375-8196397 TGGTATCACATCACATTCACGGG + Intergenic
1187023366 X:15407406-15407428 TAGTATTCAATTACATAAAATGG + Intronic
1188618985 X:32196069-32196091 TGGTATTCCATGAAATCATCAGG + Intronic
1189306181 X:39988325-39988347 TGTTCTTCCATTATATTAAAAGG - Intergenic
1190500886 X:51077464-51077486 TAGCATTCCATTATATTAATAGG + Intergenic
1191082459 X:56527916-56527938 ACGTAATCCATTATATTAACAGG - Intergenic
1191743007 X:64455519-64455541 TGTTGTTTCATTGCATTAACTGG - Intergenic
1192695723 X:73413947-73413969 TGCTATTCCATTACTTTACTTGG - Intergenic
1193715657 X:84933006-84933028 TGGTATTTCACCACAGTAACAGG + Intergenic
1194588369 X:95766201-95766223 TGCTATACCATTGCATTAAAAGG - Intergenic
1195450964 X:105012342-105012364 TTGTATTTCATTCCATTGACAGG - Intronic
1197133155 X:123029367-123029389 TGATATTCTATTTCATTATCTGG + Intergenic
1197180901 X:123535630-123535652 TAGTATTCCATTACATAGAGTGG - Intergenic
1201527114 Y:14948692-14948714 GGGTATTCAATTACGTGAACAGG - Intergenic
1201532529 Y:15007870-15007892 TGATATTTCATGACATTAAATGG + Intergenic