ID: 962961007

View in Genome Browser
Species Human (GRCh38)
Location 3:140310902-140310924
Sequence GCCTCTGTGTTAGGTGCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 315
Summary {0: 1, 1: 0, 2: 4, 3: 47, 4: 263}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962961004_962961007 -9 Left 962961004 3:140310888-140310910 CCTAGTACAAACCAGCCTCTGTG 0: 1
1: 0
2: 0
3: 19
4: 177
Right 962961007 3:140310902-140310924 GCCTCTGTGTTAGGTGCTGCAGG 0: 1
1: 0
2: 4
3: 47
4: 263

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962961007 Original CRISPR GCCTCTGTGTTAGGTGCTGC AGG Intronic
900216786 1:1486039-1486061 GCCTCGGTGACAGGGGCTGCGGG - Intronic
900721709 1:4180395-4180417 GCCTCTGTGGTCAGTGCTCCTGG - Intergenic
900897105 1:5491089-5491111 GCCTGTGTGTTTGGGGGTGCAGG - Intergenic
900998309 1:6134615-6134637 GCCGCTGTGATAGGTTCTCCTGG - Intronic
902557674 1:17256547-17256569 GGCTCTGTGTGAGATGCTGGGGG - Intronic
902711616 1:18243765-18243787 GCCCTTGTGTTGGGTGCTGCTGG + Intronic
903179997 1:21600403-21600425 GCCTCTGTGTTGGGCTCTGTGGG - Intronic
903328853 1:22586686-22586708 GCCCCTGTGTTTGGTCCTCCAGG + Intronic
903397045 1:23009605-23009627 GCCACTGTGTTAGGTGCTACGGG + Intergenic
904675236 1:32195127-32195149 GCTTCTGTGCTCGGTGCTCCTGG - Exonic
905521642 1:38605082-38605104 GCATCTCTCTAAGGTGCTGCAGG - Intergenic
905807432 1:40887034-40887056 GGCTCAGTGTTTGGTGCTGCGGG + Intergenic
906003867 1:42451944-42451966 GACCCTGTGTTAGGTGTTACAGG - Intronic
906952818 1:50348556-50348578 GGCTCTGTGTTAGGCACTGGGGG + Intergenic
907846982 1:58217811-58217833 GGCTCTGTGTTAGGTACTATGGG - Intronic
909042194 1:70668098-70668120 GCCTCTGTGTCAGCTGCTCAGGG - Intergenic
911445422 1:97985981-97986003 GGCTCTGTGCTAGGTGCTGGGGG + Intergenic
912967443 1:114248741-114248763 CCCCCTGTGGTTGGTGCTGCTGG - Intergenic
914782248 1:150796175-150796197 GATACTGTGTTAGGTGCTGGAGG - Intergenic
915456691 1:156045038-156045060 AGCTCTGTGCTAGGTGCTGGAGG - Intronic
917261601 1:173175342-173175364 GCCACTGTGTTAGGTGTTCTGGG - Intergenic
920436590 1:205950770-205950792 CACTCTGAGGTAGGTGCTGCTGG - Intergenic
920828529 1:209445227-209445249 GCTGCTGTGGTGGGTGCTGCTGG - Intergenic
920949394 1:210558156-210558178 GGCTCTGTGTTAGGTGTTATGGG - Intronic
921526148 1:216221033-216221055 GCCTTTGTGTTAGGGACTGATGG - Intronic
921949064 1:220910153-220910175 GCCTCTGTGCCAGGTGCTGTGGG + Intergenic
922550431 1:226490450-226490472 ACCTGTGTCTTAGGGGCTGCTGG + Intergenic
922713600 1:227852836-227852858 GCCCATGTGTAAGCTGCTGCTGG + Intergenic
923240286 1:232077960-232077982 GCCTCAATGTAAGGTGGTGCTGG + Intergenic
924897689 1:248360141-248360163 GACTCTGTGTTAGCTAGTGCAGG - Intergenic
1063555873 10:7079078-7079100 GCTGCTGTGTCAGGTGCTGCGGG - Intergenic
1064093008 10:12401479-12401501 GGGCCTGTGTTAGGTGCTGGGGG + Intronic
1064193480 10:13227196-13227218 ACCCCTGGGTCAGGTGCTGCAGG - Intronic
1069885837 10:71623042-71623064 GCCACTGTGCTAGGTCCTGGGGG + Intronic
1071179185 10:82962961-82962983 TTCTCTGTGTTGGGTACTGCAGG + Intronic
1075068039 10:119302815-119302837 GCCTCTCTGTCAGGGGCTTCTGG + Intronic
1076480746 10:130783741-130783763 GCATCTGTGTGAGGGGGTGCTGG + Intergenic
1077091174 11:779001-779023 GGCTCTGTGTCAGGTGAGGCAGG - Intronic
1077109553 11:856062-856084 GCCTCTTGGGCAGGTGCTGCGGG - Intronic
1077487524 11:2845910-2845932 GCCTCCGTGGTAGGTGCTGTGGG + Intronic
1079091853 11:17486221-17486243 GACTCAGAGTTAGGAGCTGCAGG + Intergenic
1079158171 11:17968138-17968160 GGCTCTGTGTTAGGTGCTGTGGG - Intronic
1080054031 11:27886756-27886778 GGCACTGTGTTAAATGCTGCAGG - Intergenic
1080681765 11:34483399-34483421 GGCAGTGTGCTAGGTGCTGCAGG - Intronic
1081444774 11:43120031-43120053 AGCTCTGTGCTAGGTGCTGGAGG - Intergenic
1081706287 11:45183515-45183537 GGCTCTGGGCTAGGTGCTGGGGG + Intronic
1082783454 11:57303626-57303648 GGCTCTGGGTCAGGTGCTGGGGG - Intronic
1083295141 11:61711265-61711287 GCCTCTGTGATGGGTGCGGCCGG - Intronic
1084479843 11:69413508-69413530 GTCTCTGTGGAAGGAGCTGCTGG - Intergenic
1084863633 11:72038887-72038909 GCCTCTGTTTTAGATTCTGGGGG - Intronic
1085934917 11:81129636-81129658 ACCTCTGTGTTAAGGGCTGGTGG - Intergenic
1086492177 11:87366523-87366545 GCCTCTGTGGTTGCTGGTGCTGG + Intergenic
1086958028 11:92954021-92954043 GCCTGTGGGCCAGGTGCTGCTGG - Intergenic
1087236550 11:95724965-95724987 GACTCTGTGAAAGGTGGTGCTGG + Intergenic
1087522720 11:99262855-99262877 AGCTCTGTGCTAGGTGTTGCAGG - Intronic
1090084410 11:123638789-123638811 GCCTCTGTCTTTTGAGCTGCCGG + Intronic
1090417983 11:126554036-126554058 GGAACTGTGTGAGGTGCTGCTGG - Intronic
1090772110 11:129930344-129930366 GACTCTGAGTTAGGAACTGCAGG - Intronic
1091742660 12:2971081-2971103 GGCACTGTGCTAGGTGCAGCGGG + Intronic
1091768348 12:3136436-3136458 GCCCCTGTGTCAGGTACTGGGGG + Intronic
1092144208 12:6203442-6203464 GCCTCTGTGCAAAGTGCTGCTGG - Intronic
1093865421 12:24221376-24221398 GGCTCTGTTTTAAGTGCTGGAGG - Intergenic
1094399879 12:30050965-30050987 GGCCCTGGGTTAGTTGCTGCAGG + Intergenic
1094628666 12:32150713-32150735 GCCCCTGTGTCAGGTTGTGCAGG - Intronic
1096088151 12:48880177-48880199 GGCTCTGTGCTAAGTGCTGTTGG + Intergenic
1096816579 12:54205551-54205573 TCCTCTCTGTCTGGTGCTGCTGG + Intergenic
1096918108 12:55055173-55055195 GCCTCTGTGTTAGATGCAGAGGG - Intergenic
1097401823 12:59137004-59137026 CCCTCTTTGTTAGGTTCTGTGGG + Intergenic
1098481034 12:70961864-70961886 GCCTTTTTGTTATTTGCTGCTGG - Intergenic
1098593502 12:72242514-72242536 CCCTCTGTTTTGGGTGCTGTAGG + Intronic
1100616985 12:96238464-96238486 GCCCTTGTGTGAGCTGCTGCTGG + Intronic
1101989246 12:109470911-109470933 TGCTCTGTGTTGGATGCTGCTGG - Intronic
1102172883 12:110855461-110855483 GCCTGTGTGTGGGGTGCTGTTGG - Intronic
1102722097 12:115025496-115025518 GCCTCTCTCTTAGCTGCTGGTGG - Intergenic
1104384553 12:128339121-128339143 GCGTCTGTGTTGGGGGCTGGGGG + Intronic
1105442942 13:20430352-20430374 GTCTCTGTGTTGGCTGCTGTGGG - Intronic
1105535168 13:21259315-21259337 GCCACTGTGTGAGCTGCTACCGG + Intergenic
1105800217 13:23896599-23896621 GACTCTGTGCCAGGTGCTGGTGG - Intronic
1105848797 13:24316377-24316399 GACTCTGTGCCAGGTGCTGGTGG + Intronic
1107277510 13:38692840-38692862 TCCTCTGTGTTGTATGCTGCAGG + Intronic
1108448164 13:50529674-50529696 GACTCTGTGCTAGTTGCTACTGG + Intronic
1110250209 13:73372702-73372724 GGCTATGTGTTAGGTCCTGAGGG + Intergenic
1112247326 13:97746937-97746959 GACCCTGTGCTAGGTGCTGAAGG - Intergenic
1112337117 13:98524941-98524963 GCCTCTGTGTCAGCAGCTGTAGG + Intronic
1112720044 13:102233531-102233553 GGCTCTGTTATAGGTGCTGGGGG - Intronic
1113546921 13:111159882-111159904 GCCTCTGTTTTCGGTGCTTTTGG + Intronic
1113755794 13:112809761-112809783 GCCTTTGTGTTTGGCGTTGCTGG - Intronic
1113784508 13:112995465-112995487 GCCGCTGTGTGAGCTGCTGCTGG + Intronic
1113870786 13:113558643-113558665 GCCTCTCTGCTAGCTGATGCAGG - Intergenic
1113912510 13:113850166-113850188 TGCTCTGTGTTTGGTTCTGCAGG - Intronic
1114597993 14:23930685-23930707 GTCTCTGTGTAAAGTCCTGCTGG - Intergenic
1117410858 14:55449697-55449719 ACCTCTCTCTTAGCTGCTGCTGG - Intronic
1117747018 14:58879969-58879991 GGCCCTGTGTTAGGTGCTGTGGG - Intergenic
1118228265 14:63923545-63923567 AGCTCTGGGGTAGGTGCTGCAGG + Intronic
1118330147 14:64808629-64808651 GGCCCTGTCCTAGGTGCTGCAGG + Intronic
1118689555 14:68324964-68324986 GGCACTGTGTTAGTTGCTGTGGG - Intronic
1120399423 14:84009887-84009909 CCCTCTGTGTTCGATGGTGCTGG - Intergenic
1121876742 14:97459624-97459646 GCCTCTGTGTTATTTGCGGATGG + Intergenic
1122374797 14:101250643-101250665 AGCTCTGTGCTAGGTGCTGGGGG + Intergenic
1122503598 14:102217917-102217939 GCCTCTGTGGCAGGTGCTCCTGG - Intronic
1122656177 14:103260831-103260853 GGCTGTGTGTGAGGTGCTGCAGG + Intergenic
1122856463 14:104562594-104562616 GCCTCTGTGTGAGGTGGATCAGG + Intronic
1122970616 14:105150676-105150698 GCCGCTGTGGCAGGGGCTGCTGG + Exonic
1202923307 14_KI270724v1_random:3831-3853 TCCTCCGTGGTAGGTGCTGTTGG + Intergenic
1125333879 15:38608376-38608398 GCCTCTGTGTGAGGTGTTTCTGG - Intergenic
1125896749 15:43308873-43308895 GCCTCTGTGTCAGGTGCTGAGGG + Intergenic
1126694884 15:51317507-51317529 GCCCCTGTGCAAGATGCTGCAGG + Intronic
1127187459 15:56494123-56494145 GCCACTGTGCTGGGTGCTGTAGG - Intergenic
1128181244 15:65606588-65606610 GACACTGTGTTAGGCACTGCTGG + Intronic
1128230070 15:66028221-66028243 GGGTCTGTGCTGGGTGCTGCAGG - Intronic
1128391400 15:67185174-67185196 GGCTCTGTGCCAGGTGCTGTAGG + Intronic
1129155302 15:73713871-73713893 AGCACTGTGTTAGGTGCTGGGGG + Exonic
1132011996 15:98284278-98284300 GCCTCTGTGCTAGGCGCTGGGGG + Intergenic
1133021494 16:2968928-2968950 GGCTCTGTCCAAGGTGCTGCCGG - Intronic
1133109233 16:3535882-3535904 GCATCTGGGTGTGGTGCTGCAGG - Intronic
1135106357 16:19653309-19653331 CCCTCTGTGTTACGGCCTGCAGG - Intronic
1135112285 16:19699600-19699622 GCCTCTGTGCCAGGTGCCACAGG - Exonic
1135149943 16:19996644-19996666 GGCATTGTGTTAGGTGCTGGGGG - Intergenic
1135285297 16:21187967-21187989 GTGCCTGTGTTGGGTGCTGCTGG + Intergenic
1135428360 16:22359707-22359729 GCCTCTGTTTTAGGAGATTCAGG - Intronic
1135612848 16:23883456-23883478 GCCTCTGTGCTAAGTGCAGTGGG + Intronic
1136032843 16:27516073-27516095 TCCCCTGTGCTAGGTGCTGGTGG - Intronic
1136227250 16:28867172-28867194 GGCTCTGTGTTAGCAGCTGCGGG + Intronic
1138700716 16:58860034-58860056 GCCACTGTGTCAGGGGTTGCTGG + Intergenic
1139663070 16:68435515-68435537 ACCTCTGTGTTAGGGGATACGGG - Intronic
1139732561 16:68959232-68959254 GTCTTTGTGATAGGTGCTCCAGG - Intronic
1140757167 16:78078118-78078140 GCCTGTGTGTTTGCTGATGCTGG - Intergenic
1141254028 16:82384225-82384247 TCCTCTGTGACAGGTGCTGGGGG + Intergenic
1141700586 16:85640323-85640345 GCCGCTGTGTTACCTGCGGCAGG + Intronic
1142195515 16:88737615-88737637 GCCTCGGTGTCGGGTGCTGTGGG + Exonic
1142498474 17:319549-319571 GACTCTGTGTCCTGTGCTGCAGG - Exonic
1142546771 17:709625-709647 GTCACTGTGCTAGGTGCTGAGGG - Intronic
1142601453 17:1054849-1054871 ACCTCTGTGTGGGGCGCTGCAGG + Intronic
1142686930 17:1582691-1582713 GGCTCTGTGCTTGCTGCTGCAGG - Intronic
1142742767 17:1940678-1940700 GGCTCTGTGGAAGGTGCAGCTGG - Intronic
1144948203 17:18980562-18980584 GCCTGTGTGTTATGAGCTCCAGG + Intronic
1146516223 17:33491657-33491679 GCCCCTGTGTTAGAAGCTGTTGG + Intronic
1147627225 17:41907998-41908020 GCCTCAGTGTCAGGTGGAGCAGG + Intronic
1147906810 17:43828827-43828849 GGCTCTGTATTGGGTGCTGGCGG - Intronic
1148667059 17:49382765-49382787 CCCTCTGTGCCAGATGCTGCGGG - Intronic
1149489025 17:57068619-57068641 GCCCCTGTCTTAGGTTCTGTTGG - Intergenic
1150067721 17:62125461-62125483 GACACTGTGTTAGGTGCCGGTGG - Intergenic
1151887366 17:76931020-76931042 GGCTCTGTTTCAGGTGCTGGTGG + Intronic
1155440272 18:25854946-25854968 GCCTCTTTCTTAGATGCTGCAGG + Intergenic
1155821656 18:30385612-30385634 GCTTCTGTGTGAGTTGCGGCTGG - Intergenic
1156479231 18:37425877-37425899 GGTTCTCTGTTAGGTGCTGGGGG + Intronic
1156856652 18:41790304-41790326 GCCTCTGTGTTAGTGGTGGCTGG + Intergenic
1157159850 18:45303899-45303921 GACTCTGTGCTAGATGCTGGAGG - Intronic
1157713583 18:49866719-49866741 GGCACTGTGCTAGGTGCTGCAGG + Intronic
1162418999 19:10555198-10555220 GCCCCTGTGTTGGGTGCTCTGGG + Intronic
1162545183 19:11324909-11324931 GCCTCTTTCTCAGGTCCTGCAGG - Exonic
1164714130 19:30379271-30379293 GCCTCTGTGTTGGGAGCTCCCGG + Intronic
1164720794 19:30430369-30430391 GGCTCTGTGTTGGGTGCTGGGGG + Intronic
1168013491 19:53553831-53553853 GCCTCTGAGTGGGGTGATGCCGG - Intronic
1168098513 19:54128730-54128752 GCCTCTGAGTTCGGTCCTGCAGG - Intronic
925797529 2:7563116-7563138 GGCTCTGTGTTAGGTGCTATGGG - Intergenic
926270909 2:11365317-11365339 GCCTCTGTATTGGCTGGTGCAGG + Intergenic
926301285 2:11605024-11605046 GCCTCTGTGGTAGGTACTAAAGG - Intronic
926809774 2:16745966-16745988 GCATCTGTGGTAGATGCTGGTGG + Intergenic
927369411 2:22337385-22337407 GGCTCTGTGCTAAGTGCTGTGGG + Intergenic
927751242 2:25673020-25673042 GGCTCTGCGTTAGGTGCTGAAGG - Intronic
927866944 2:26595162-26595184 GCATCTATGGTAGGTGCTGTGGG - Exonic
928677606 2:33664628-33664650 ACCTCTCTGTTAGTTGCTTCAGG - Intergenic
929568441 2:43005190-43005212 GGCTCTGTCGTAGGTGCTGGGGG - Intergenic
929781375 2:44959388-44959410 GGCTTTGTGTTAGGTGCTGTGGG - Intergenic
931464578 2:62475228-62475250 GCATCTGTGCTAGGACCTGCCGG - Intergenic
932613651 2:73218336-73218358 GGCACTGTGCTAGGTGCTGTGGG + Intronic
932825764 2:74938572-74938594 GTCTATCTGTTAGGTGCTGTGGG + Intergenic
933701628 2:85259125-85259147 GCCACTGTGTGTGGTGCTGTGGG - Intronic
933703297 2:85271538-85271560 GCATCTGTGCTGGGTCCTGCAGG - Intronic
934900321 2:98154702-98154724 CCCCGTGTGTTAGGTGATGCAGG - Intronic
936729292 2:115361052-115361074 GCTTGTCTGTTAGGTGCTGCAGG + Intronic
937036626 2:118787555-118787577 AGCTCTGTGCTAGGTGCTGAGGG + Intergenic
938262452 2:129905575-129905597 GCCTCTTTGTTTGGAGGTGCTGG - Intergenic
938927894 2:136061102-136061124 GGCATTGTGTTAGGTGCTTCAGG - Intergenic
938985513 2:136571601-136571623 GCCTGGGTGTTGGGGGCTGCTGG + Intergenic
941603872 2:167571541-167571563 CCCTCTGTGTGAGGTGCTATGGG - Intergenic
942069534 2:172304005-172304027 AGCTCTGTGATAAGTGCTGCAGG + Intergenic
945046505 2:205786722-205786744 GCCTCTGTGTTAACTGAGGCTGG - Intronic
946510291 2:220348704-220348726 AGCTCTCTGTTAGGTGCTGCTGG + Intergenic
947705736 2:232273999-232274021 GGTTCTGTGTTAGCTGCTGCTGG + Intronic
948231697 2:236353775-236353797 GTCGCTGAGTGAGGTGCTGCGGG + Intronic
948799798 2:240427370-240427392 GCCTCTGAAGCAGGTGCTGCAGG - Intergenic
1168891110 20:1295876-1295898 CCCTCTCTGGTAGGGGCTGCAGG - Intronic
1169137289 20:3204734-3204756 GCCTCTCTGTGATGTGCCGCTGG - Intergenic
1169250854 20:4060304-4060326 GCCTTTGTCTCAGGTTCTGCTGG - Intergenic
1170984184 20:21242971-21242993 GACACTGGGCTAGGTGCTGCAGG - Intronic
1172163133 20:32882391-32882413 GGAACTGTGTGAGGTGCTGCTGG - Intronic
1172590650 20:36115459-36115481 GGCTGTGTGTTAGGTGTTTCAGG + Intronic
1173207893 20:41008677-41008699 GCCCCAGTGTTCTGTGCTGCTGG - Intergenic
1174773495 20:53322884-53322906 GCCTCTGTGTTTGGTGCTCATGG + Intronic
1175195658 20:57241626-57241648 GCCTCCTTGTTAGGTGCTGGGGG + Intronic
1175950724 20:62581664-62581686 GGCTGTGTGTTACGTGCTGTGGG + Intergenic
1176269029 20:64225859-64225881 CCCTGTGTGTTAGGTACTGCCGG + Intronic
1176300941 21:5098792-5098814 GGCTCTATGTTGGGTGCAGCAGG + Intergenic
1176312310 21:5158641-5158663 GCCTTTGTGCTCGCTGCTGCAGG + Intergenic
1176424217 21:6538095-6538117 GCCTCTGGGTGAGCTGCAGCAGG - Intergenic
1178549393 21:33523363-33523385 GCCACAGTGTTAGTTGCTACTGG - Intronic
1178818699 21:35955226-35955248 GCTTCTGTTCTAGGTGTTGCTGG - Intronic
1178983786 21:37286096-37286118 GCCTCTGTGCTGGCTTCTGCTGG + Intergenic
1179042487 21:37816216-37816238 CGCTCTGTGGTAGGTGCTGCAGG + Intronic
1179574424 21:42298853-42298875 GCATCTGTCCTAGGTGCAGCCGG + Intergenic
1179699710 21:43146410-43146432 GCCTCTGGGTGAGCTGCAGCAGG - Intergenic
1179844738 21:44103389-44103411 GCCTTTGTGCTCGCTGCTGCAGG - Exonic
1179856087 21:44163106-44163128 GGCTCTATGTTGGGTGCAGCAGG - Intergenic
1180022483 21:45137283-45137305 TCCCCTGTGTAAGGTGCTGGAGG + Intronic
1182041021 22:27239224-27239246 GGCTCTGTGTCAGCTGCAGCTGG + Intergenic
1182401004 22:30078022-30078044 GCCCCTGTGCTAGGAGCTGTTGG - Intergenic
1182621835 22:31622701-31622723 TCGTCTGTCTTAGGTGCTCCAGG - Intronic
1183120527 22:35726939-35726961 GCCTGGGTGATGGGTGCTGCTGG + Exonic
1183717938 22:39545116-39545138 GGCTCTGTGCTAGCTGCTGGGGG + Intergenic
949096029 3:86850-86872 TCCTCTCTGTTATGTGATGCAGG - Intergenic
949218525 3:1600924-1600946 TCCTCTGTGCTAAGAGCTGCAGG - Intergenic
950432364 3:12958224-12958246 GCCCCTGTGCTGGGTGCTGTGGG - Intronic
951574780 3:24102479-24102501 GGCACTGTGTTAGGTGCTGTAGG - Intergenic
953417253 3:42730119-42730141 GGCACTGTGCTTGGTGCTGCTGG - Intronic
953756025 3:45646498-45646520 GCTGCTGTGTTAGATGGTGCAGG - Intronic
956095993 3:65716767-65716789 GGCTTTGTGTTAGGTGCTAGGGG + Intronic
956121350 3:65969337-65969359 GGTTCTGTGTTAGGGGCTGGGGG + Intronic
957036453 3:75297887-75297909 GACACTGTGCTGGGTGCTGCAGG + Intergenic
959020620 3:101184185-101184207 GGAACTGTGTAAGGTGCTGCTGG + Intergenic
959089694 3:101888801-101888823 GCCTCTGGGTTAGGGCCTGTTGG + Intergenic
961115214 3:124323448-124323470 GGCTCTGTGTTGGGGGCTGTAGG - Intronic
962234169 3:133693599-133693621 GCCTCAGTGTCAGGTGCTACTGG + Intergenic
962961007 3:140310902-140310924 GCCTCTGTGTTAGGTGCTGCAGG + Intronic
963079692 3:141379352-141379374 GCCTCCATCTTAGGTGATGCTGG - Intronic
963676524 3:148318076-148318098 GCCTCTGTTTTTGGTGTTGCAGG - Intergenic
964055452 3:152450733-152450755 GCTACTGTGTTAGGTTGTGCGGG - Intronic
964572735 3:158128043-158128065 GTCTCTGTCTTTGGTACTGCTGG + Intronic
965628059 3:170702014-170702036 GCCTTTCTGTTACTTGCTGCAGG - Intronic
966424261 3:179764055-179764077 GCCTCTGTTTTTGGTGCTTCTGG + Exonic
968417375 4:451940-451962 GGCTGTCTGTGAGGTGCTGCAGG + Intronic
969717409 4:8874440-8874462 GCCTCTGTGCTCGGTGCTGGTGG + Intergenic
970317996 4:14847515-14847537 GCCTCTGTATTTGGTGTTGATGG + Intergenic
970838521 4:20439401-20439423 GCCTCTCTCTTAGCTGCTGGTGG + Intronic
971703753 4:30013144-30013166 GCCTCTCTGTTAGGAGAGGCAGG + Intergenic
972344084 4:38178096-38178118 GACTCTGTGCTAGGTACTGAGGG + Intergenic
974405851 4:61468345-61468367 GACTCAGTGTGAGGTGCAGCTGG + Intronic
978066338 4:104407371-104407393 GGCACTGGGTTAGGTGCTGATGG + Intergenic
980893780 4:138841560-138841582 GCCTCTGTGTTAGGTGCCCCAGG - Intergenic
983155091 4:164337344-164337366 GCCTTGGGGTAAGGTGCTGCAGG - Intronic
985538963 5:479026-479048 CCCTCTGTGTGAGGGTCTGCAGG + Intronic
985654082 5:1120985-1121007 TCCTCTGAGTGAGGTGCAGCTGG - Intergenic
986211972 5:5682510-5682532 ACCTCAGTGCTAGGAGCTGCTGG + Intergenic
989142056 5:38211173-38211195 GCCACTGTCCTAGGTGCTGGAGG - Intergenic
990344206 5:54855341-54855363 TACTCTGTGTTAGGCACTGCTGG + Intergenic
990508915 5:56472161-56472183 ACCACTGTGGTAGGGGCTGCTGG - Intronic
991094700 5:62727575-62727597 GCCTCTGTGATGGGTGTTGGTGG - Intergenic
993002211 5:82392583-82392605 ACCTCTGTGTATGGAGCTGCCGG + Intergenic
993190327 5:84672233-84672255 GAAACTGTGTGAGGTGCTGCTGG + Intergenic
995030648 5:107477020-107477042 CACTATGTGCTAGGTGCTGCTGG + Intronic
997216440 5:132114991-132115013 GCCTCTGTCCTAGGTGCTATGGG - Intergenic
998888453 5:146720090-146720112 GCATCTGAGTTAGCAGCTGCTGG + Intronic
1001329047 5:170749366-170749388 GCCTCTGTGTTTGGTTCCACCGG - Intergenic
1001626746 5:173142679-173142701 GCCTCTCTATTAGGTGCAGTGGG + Intergenic
1002054971 5:176593623-176593645 GGTTCTGTGTGTGGTGCTGCGGG + Intronic
1002484091 5:179523038-179523060 GCCTCTGTGTGAGGTGCTCTGGG + Intergenic
1002500474 5:179644443-179644465 GCCTCTGTGTGAGGTGCTCTGGG - Intronic
1003121194 6:3320152-3320174 GCCTCTGTGTCTGCTCCTGCTGG + Intronic
1003300285 6:4874483-4874505 GCTGCAGTGTTAGGTGCTGTTGG + Intronic
1006512275 6:34528147-34528169 GGCACTGTGTTAGGTGGTGCAGG - Intronic
1006803050 6:36771612-36771634 GGCACTGTGTTGGGTGCTGTGGG - Intronic
1007211435 6:40196040-40196062 GCCTGTGTTTCAGGGGCTGCTGG - Intergenic
1007718049 6:43868778-43868800 GCCTCTGTATCAGGTGCTAGAGG - Intergenic
1009911771 6:69938643-69938665 CCATATGTGTTAGGTGCTGTAGG + Intronic
1010606842 6:77900609-77900631 GCATCTGTGATAGGTACTGAAGG + Intronic
1013076181 6:106773682-106773704 GCCTCTGCGGTGGATGCTGCTGG - Intergenic
1013639384 6:112058442-112058464 GGCACTGTGCTAGGTGCTGGTGG + Intronic
1015746552 6:136515972-136515994 GACTCTGTATTAGTTGCTGGGGG + Intronic
1018279248 6:162166978-162167000 GACTCTGTTTTAGGTGCAGGTGG - Intronic
1019014621 6:168870997-168871019 GCCCCTTTGTTAAGGGCTGCTGG + Intergenic
1023389268 7:39692719-39692741 TACTCTGAGTCAGGTGCTGCAGG - Intronic
1024035472 7:45504452-45504474 GCCTCTGGGTTGGGGGCTACAGG - Intergenic
1026498543 7:70923646-70923668 GCCTCTGCGGTATGTGCTGAGGG - Intergenic
1029521383 7:101064867-101064889 GGCACGGTGTTAGGTGCTGTGGG - Intergenic
1029642226 7:101828556-101828578 ACCTCTGTGTTTCTTGCTGCTGG - Intronic
1030783325 7:113628000-113628022 TGCTGTGTGTTAGGTGCTGTTGG - Intergenic
1033119646 7:138656099-138656121 GCCTCAGTGTTAATGGCTGCTGG - Intronic
1033174095 7:139109205-139109227 GCAGCTCTGTGAGGTGCTGCAGG - Exonic
1034231548 7:149532985-149533007 ACCTCCCTGTTAGGTGCTCCAGG - Intergenic
1034576727 7:152006171-152006193 GCCACTGTGTTGGATGCTGCTGG - Intronic
1034588187 7:152114886-152114908 GGCTCTGTGTTAGGTTTTGGGGG + Intronic
1035058121 7:156050420-156050442 GCCTCTGTGGGAGGTACAGCTGG - Intergenic
1035356345 7:158277990-158278012 GCCTCCCTGTTATGTGCTGGAGG - Intronic
1035649139 8:1251650-1251672 GCCTCTGTGTCAGGTCATGTTGG + Intergenic
1038223073 8:25629090-25629112 GCCTCGGAGTTAGAGGCTGCAGG + Intergenic
1038425260 8:27460513-27460535 GGCGCTGTGCTAGGTGCTGGGGG + Exonic
1044632573 8:94293458-94293480 GCCACTGTCATGGGTGCTGCAGG + Intergenic
1045382929 8:101644795-101644817 GCCTCAGTGTTGGCTGCAGCAGG - Intronic
1046183732 8:110686276-110686298 GCCACTGTGCTAGGTGCTGTGGG + Intergenic
1046752748 8:117942373-117942395 GCCTCTGTGCTAGGTTCTGGGGG - Intronic
1050560909 9:6833703-6833725 GAATCAGTGTTAGCTGCTGCAGG + Intronic
1051728638 9:20114810-20114832 GCCTCTCTGTAAGATGCTGTAGG + Intergenic
1053377828 9:37623134-37623156 GACACTGTGTTAGGTGCTGAGGG + Intronic
1053509351 9:38674105-38674127 GCTGCTGTATTTGGTGCTGCTGG + Intergenic
1055687237 9:78789802-78789824 GACACTGTGATAGTTGCTGCAGG + Intergenic
1056100504 9:83296435-83296457 AGCACTGTGTTAGGTGCTGGGGG + Intronic
1061387001 9:130296274-130296296 GGCACTGTGCTAGGTGTTGCAGG + Intronic
1061843701 9:133375548-133375570 GCCTCGGCGTTTGGAGCTGCTGG - Intronic
1062709845 9:137969118-137969140 GCATCTGTCTTGGGTGCTGCTGG + Intronic
1186028900 X:5345702-5345724 GGCTCTGAGTTGGGTGCAGCAGG + Intergenic
1187069244 X:15871778-15871800 GCTTGTGTGTTAGGTGCTTTGGG - Intergenic
1187143478 X:16616540-16616562 GCCTCTAGGTTAGGTGCTCTGGG - Intronic
1187485754 X:19701554-19701576 GTATTTGTGTTAGGTGCTGGAGG - Intronic
1187575459 X:20549480-20549502 GCCTCTGTGCCAGGTGCACCAGG - Intergenic
1190744524 X:53314327-53314349 GGTTCTGTGTTAGGTGCTGTGGG - Intronic
1192182584 X:68925598-68925620 GCCATTGTGTTGGGTGCTGAGGG - Intergenic
1192550461 X:72049311-72049333 GCCTCGGTGTGTGGTTCTGCAGG + Intergenic
1192744291 X:73923419-73923441 TCCTCTGTGTGAGGAGCTGCCGG + Intergenic
1192845489 X:74902886-74902908 GCCTGTGTGATAGGTGTGGCAGG + Intronic
1195355274 X:104033623-104033645 GTTTCTGGGTTAGGTTCTGCAGG + Intergenic
1195922537 X:109998043-109998065 GCCACTCTGCTAGGTGCTGTGGG + Intergenic
1197255210 X:124255789-124255811 ACCACTGTGGTAGGTTCTGCAGG + Intronic
1198432994 X:136586660-136586682 TCCTCTGTGTTAGGTGTTGGAGG + Intergenic
1198587978 X:138143893-138143915 GGCTCTGTGCTAGGTCCTGGGGG + Intergenic