ID: 962964207

View in Genome Browser
Species Human (GRCh38)
Location 3:140338560-140338582
Sequence TACTGAGGCCGGGGGGGGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 195}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962964207_962964218 21 Left 962964207 3:140338560-140338582 CCAGTCCCCCCCCGGCCTCAGTA 0: 1
1: 0
2: 2
3: 10
4: 195
Right 962964218 3:140338604-140338626 CAGAATTGTCAGGTGTTGTGTGG 0: 1
1: 0
2: 1
3: 24
4: 230
962964207_962964217 11 Left 962964207 3:140338560-140338582 CCAGTCCCCCCCCGGCCTCAGTA 0: 1
1: 0
2: 2
3: 10
4: 195
Right 962964217 3:140338594-140338616 ACGGTGCACTCAGAATTGTCAGG 0: 1
1: 0
2: 0
3: 5
4: 67
962964207_962964216 -8 Left 962964207 3:140338560-140338582 CCAGTCCCCCCCCGGCCTCAGTA 0: 1
1: 0
2: 2
3: 10
4: 195
Right 962964216 3:140338575-140338597 CCTCAGTAGTGCTCAGTGAACGG 0: 1
1: 0
2: 0
3: 13
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962964207 Original CRISPR TACTGAGGCCGGGGGGGGAC TGG (reversed) Intronic
900366215 1:2312956-2312978 CACTGAGACCGGGGGGTGGCAGG - Intergenic
900479885 1:2892943-2892965 AACTGAGGCACGGGGGGGGCTGG + Intergenic
900530514 1:3150851-3150873 TATGGAGGCCGGGTGGGGGCGGG + Intronic
900562828 1:3316135-3316157 GACTGAGGGCGGGTGGGGGCGGG + Intronic
901272250 1:7961584-7961606 GACTGAGGCGGGGGTGGCACCGG - Intronic
902520138 1:17011413-17011435 TCCTGGGGCCGTGCGGGGACGGG - Intronic
903096559 1:20981061-20981083 TACTGAGGCCCCTGGGGCACTGG + Exonic
904482957 1:30805516-30805538 AACTGAGGCGGGGGTGGGAAGGG + Intergenic
904937325 1:34140928-34140950 AAGTGAGGCTGGAGGGGGACAGG - Intronic
905233555 1:36530285-36530307 GACTGAGGCAGGGCGGGGGCGGG - Intergenic
905626829 1:39495001-39495023 TACTGAGGCTGGGTGGGGCGGGG + Intronic
907250004 1:53131860-53131882 TGCTGTGGCCGGGAGGGAACAGG + Intronic
911811629 1:102290027-102290049 TACTGGGGCCTGTTGGGGACTGG - Intergenic
914222554 1:145693810-145693832 TCCTGAGGCTGAGGGGAGACAGG - Intronic
914237462 1:145824559-145824581 TACTGAGGCGGGGTGGGGACGGG + Intronic
916312604 1:163413439-163413461 TACTGCGGCAGGGGTGGGGCAGG + Intergenic
917823580 1:178792595-178792617 TACTGAGGCCAGGGGTGGAGAGG - Intronic
922955700 1:229597535-229597557 TGCTGAGGCCCGTGTGGGACTGG - Intronic
923473659 1:234313598-234313620 CATTGAGGGCTGGGGGGGACAGG + Intronic
924495435 1:244584374-244584396 TACTGAGACTGGGAGGGGAAAGG + Intronic
1065749582 10:28873685-28873707 TCCTGTGGCCTGGGGAGGACAGG + Intronic
1065829895 10:29605366-29605388 TGCTGAGGCTGGGGGGAGACGGG - Intronic
1068783137 10:60943587-60943609 TGGGGAGGCCGGGCGGGGACCGG - Intronic
1070770492 10:79079630-79079652 CACTGGGGCCGGGGGGGTCCAGG + Intronic
1070796759 10:79221450-79221472 TACTGAGGAGGGAGGGGGCCTGG - Intronic
1073444526 10:103572580-103572602 TACTGGGGCCGGAAGAGGACAGG + Intronic
1074668987 10:115765971-115765993 TAGTGAGCCGGGGGGGGGAAAGG - Intronic
1075779722 10:125009397-125009419 TCCAGAGGCCGGGGCGGGACAGG + Intronic
1075873842 10:125790165-125790187 TACTGTGGGCGGGGTGGGAGCGG - Intronic
1076260641 10:129062398-129062420 TACTGAGGCTGGGACAGGACAGG + Intergenic
1076366209 10:129922408-129922430 TGCTGAGGGCCGGGGGGCACGGG - Intronic
1076385314 10:130051449-130051471 TAATGAGGCGGGGGCGGGAGAGG - Intergenic
1076605739 10:131688987-131689009 AGCTGAGGCGGGGGGTGGACAGG - Intergenic
1076614953 10:131749092-131749114 AGCTGAGGCAGGTGGGGGACTGG + Intergenic
1076916123 10:133423830-133423852 CACTGAGGCCTGGGGGGGCGCGG + Intronic
1076936227 10:133568616-133568638 CACTGAGGCCTGGGGGGGCGCGG + Intronic
1077152296 11:1077754-1077776 GGCTGAGGCCTGGGGGGGTCAGG - Intergenic
1077467017 11:2738236-2738258 TACTGAGCCCAGGGGGAGGCAGG + Intronic
1083286839 11:61665348-61665370 GACTGAGGCTGGGGGGAGAGAGG + Intergenic
1083301987 11:61744366-61744388 TACTGAGGCCCGTGGGCGTCAGG - Exonic
1083883930 11:65561664-65561686 TACTGAGGCGGCGGTGGGAGGGG - Intergenic
1084224908 11:67710064-67710086 TACAGATGCCGAGGGGGAACTGG + Intergenic
1084262728 11:67989907-67989929 TACAGATGCCGAGGGGGAACTGG + Intergenic
1084289464 11:68152537-68152559 CACTGAGGCCTGGGGGCGGCAGG - Intergenic
1085201301 11:74703848-74703870 CACTGAGGCAGAGGGGGGAAAGG - Intronic
1085475266 11:76784935-76784957 AACTGAGGCCGGAGAGGGAAAGG - Intronic
1088321055 11:108554917-108554939 TTTGGAGGCCGGGGGGAGACAGG - Intronic
1089559083 11:119334632-119334654 GACGGGGGCCGGGCGGGGACAGG + Exonic
1090868749 11:130724719-130724741 TACTGAGCCCTGGAGGGGTCAGG + Intergenic
1091274703 11:134342437-134342459 TGCTGGGGCCGGGGCGGGGCGGG - Intronic
1092815663 12:12310436-12310458 TACCAAGACCGGGGAGGGACTGG + Intergenic
1093464880 12:19439522-19439544 TACGGAGCCCGCGCGGGGACAGG - Intronic
1096195114 12:49644689-49644711 TACTGGGGCAGGCTGGGGACTGG + Exonic
1096581028 12:52585403-52585425 TACTGAGGCCAGGGCCGGGCAGG - Intergenic
1096829261 12:54301545-54301567 TTCTGAGGCTGAGGGGGGAGGGG - Intronic
1103702444 12:122854985-122855007 GATTGAGGCCGGTGGGGGAGAGG + Intronic
1104845040 12:131842385-131842407 TGCTGAGGCCGGGAGGGTCCGGG - Intronic
1106482256 13:30145713-30145735 TACGGGGGCCGTGGGGGGTCTGG + Intergenic
1113479471 13:110610014-110610036 TATTGATGCCGGGGGGGGGGGGG - Intergenic
1114259199 14:21025224-21025246 TGCTGGGGCCGGGGGGCGAGGGG + Intronic
1115160699 14:30390291-30390313 TAATGAGGCTGGGGGTGGAAGGG + Intergenic
1121315880 14:92960758-92960780 TACTGGGGCTGAGGGGGGCCTGG + Intronic
1121434639 14:93911018-93911040 TACAGTGGCCGGGGAGGGACAGG - Intergenic
1122354076 14:101112941-101112963 TTCTGAGGCCCTGGAGGGACAGG + Intergenic
1122411596 14:101528661-101528683 GACTGAGGCAGGGTGGGGGCAGG + Intergenic
1122906629 14:104804726-104804748 TCCTGAGGACGGGTGGGAACAGG + Intergenic
1122978095 14:105179209-105179231 TGCTGAGGCCTGGGAGGGAGGGG + Intronic
1123055126 14:105565958-105565980 TACTGAGGCCGGGGTAGGGTTGG + Intergenic
1123110272 14:105863935-105863957 GACTGAGCCCGGGGAGGGCCCGG + Intergenic
1130991146 15:88876894-88876916 TCCTGAGGCGGGGGTGGGAGTGG + Intergenic
1131870970 15:96764593-96764615 CCCTGAGGCCGGAGGGGGGCGGG - Intergenic
1132318816 15:100910119-100910141 GACTGAGGTGGGAGGGGGACAGG - Intronic
1132843659 16:1990334-1990356 ACCTGAGGCCGGCGGGGGAGGGG - Intronic
1133440018 16:5813395-5813417 TACTGAGGGCCGGGGAGGAATGG - Intergenic
1134009233 16:10838953-10838975 AACTGAGGCCTGTGGGGGCCAGG + Intergenic
1134070539 16:11256952-11256974 AACTGAGGCTGGGGAGGGGCTGG + Intronic
1134098033 16:11432127-11432149 GGCTGAGGACGGGGGTGGACTGG - Intronic
1135404860 16:22190641-22190663 TTCGGAGGGCGGGGCGGGACAGG - Exonic
1135671496 16:24379550-24379572 TACTGAGGCTGGGGGTGGATAGG - Intergenic
1136569373 16:31087660-31087682 TCCTGAGGCTTGGGGGGGCCGGG + Exonic
1136999664 16:35217439-35217461 AACTGAGGCTGGGGGTGGGCAGG + Intergenic
1137003291 16:35250570-35250592 AACTGAGGCTGGGGGTGGGCAGG - Intergenic
1137946074 16:52734395-52734417 CCCTGAGGCCAGGGGTGGACTGG + Intergenic
1138203751 16:55109057-55109079 TACTCAGGCCAGGGGGAGAGGGG + Intergenic
1139957020 16:70697959-70697981 TGCAGAGGCCGTGCGGGGACAGG - Intronic
1141323022 16:83029729-83029751 TACTCAGGAAGGGAGGGGACTGG + Intronic
1142144279 16:88486342-88486364 TACTGAGGCTGGGAGGGGCATGG - Intronic
1142146222 16:88493985-88494007 AACTGAGGCCTGGAGGGGTCAGG - Intronic
1142179002 16:88658143-88658165 TGCTGAGGGCAGGGGGGGAAAGG + Intronic
1142260035 16:89038460-89038482 TACTGAGTCGGGGAGGGGATGGG - Intergenic
1142752651 17:1998068-1998090 TAATGAGGCCGGGAGAGGCCGGG - Intronic
1143110017 17:4547934-4547956 TACTGGGGCCTGGGAGGGAGGGG - Intronic
1145270379 17:21401598-21401620 AACTGAGGCCCAGAGGGGACAGG + Intronic
1146921439 17:36715309-36715331 TACTGAGGGCAGGGAGGTACTGG + Intergenic
1148458017 17:47821311-47821333 AACTGAGGCCCAGAGGGGACAGG + Intronic
1148550992 17:48550744-48550766 TACCGAAGGCGGGTGGGGACGGG + Exonic
1149660500 17:58331983-58332005 GACTGAGGCCCTGGGGGGTCAGG - Intergenic
1151561402 17:74871847-74871869 CACTGAGGACGGGAGGGGAGGGG + Intronic
1152704220 17:81834448-81834470 CACTGAGGCCCGGAGGGGTCGGG + Intronic
1152806122 17:82357204-82357226 AACTGAGGCTGGGAGGGGCCAGG + Intergenic
1160793153 19:932330-932352 AACTGAGGCTGGGCGGGGAGTGG + Intronic
1160977917 19:1802807-1802829 CCCTGAGGCCAGGTGGGGACAGG - Intronic
1162804301 19:13129056-13129078 CACTGTGGCCGGGGTGGGGCAGG + Intronic
1163694587 19:18757492-18757514 TTCTGAGGCAGGGTGGGGTCTGG - Intronic
1163782694 19:19258630-19258652 TGCGGCGGCCTGGGGGGGACCGG - Exonic
1166845708 19:45726966-45726988 TACTGAGGCTGGCTGGGCACTGG + Intronic
1167124495 19:47539819-47539841 TGCTGAGGCCAGAAGGGGACAGG - Exonic
1167567685 19:50267157-50267179 TACTGAGGCCGGGCGGGGATTGG + Intronic
1168117546 19:54232517-54232539 GACTGAGGCTGGAGGAGGACAGG - Intronic
1168123214 19:54266585-54266607 GACTGAGGCTGGGTGAGGACAGG - Intronic
1168316844 19:55488344-55488366 TGCTGAGGCATGGGGGGGAGGGG - Intergenic
927864594 2:26580450-26580472 TGCTGGGGCAGGGGTGGGACGGG + Intergenic
929604875 2:43227259-43227281 TACTGAGCCTGGGCGGGGAGGGG - Intergenic
929992883 2:46804290-46804312 CAGTCAGGCCGGGGTGGGACAGG + Intergenic
930033548 2:47072248-47072270 TGCAGAGGCCAGGGGAGGACAGG - Intronic
934923003 2:98360688-98360710 TAATGAGGCCGGGGGGAGGTGGG + Intronic
937159475 2:119746637-119746659 TACTGAGGGAGAGGGGAGACTGG - Intergenic
938118817 2:128619878-128619900 AACTGAGGCCTGGGGCGGGCAGG + Intergenic
938693720 2:133815907-133815929 TCCTGATGCTGGAGGGGGACAGG - Intergenic
938843033 2:135181312-135181334 CACTGAGGCCCGGGGTGGAGAGG - Intronic
940901454 2:159130036-159130058 TACCGGGGGCGGCGGGGGACTGG + Intronic
945292811 2:208142707-208142729 TGCTGAGGCCGGGGGAGTACAGG - Exonic
945381662 2:209147596-209147618 TGCTGAGGCCGGGGGACTACAGG + Intergenic
947640316 2:231704040-231704062 TACTCAGGCTGGGCGGGGAGAGG + Intergenic
948560658 2:238849082-238849104 TCCTGGGGCCGGCTGGGGACTGG + Intronic
948862921 2:240761570-240761592 CACTGAGGCCAGAGGTGGACAGG + Intronic
948940083 2:241191073-241191095 TTCTGGGGCAGGGCGGGGACGGG + Intronic
1170461937 20:16585607-16585629 TACTGAGGGCGTGGGGAAACAGG - Intergenic
1170918334 20:20650533-20650555 TACTGCAGCTGGTGGGGGACAGG - Intronic
1174134965 20:48373250-48373272 GAATGAGGCGGGGGAGGGACTGG - Intergenic
1174149901 20:48478556-48478578 AACTGAGGCCGGGGAGGGGAGGG - Intergenic
1175191697 20:57216125-57216147 TCCTGAAGCCGGGGGGGTCCAGG + Intronic
1176097817 20:63352362-63352384 GACTGAGACCGTGGGGGGCCAGG - Intronic
1177691106 21:24508528-24508550 TACTGAGGTAGGGAGGGGAATGG - Intergenic
1178761090 21:35403566-35403588 TAATGAGGCAGGGCTGGGACAGG - Intronic
1178931857 21:36826228-36826250 TGCTGAGGAAGGGGTGGGACTGG - Intronic
1182299843 22:29331267-29331289 CACTAAGGCCGGGGGGGTCCTGG + Intronic
1182421791 22:30252039-30252061 TACAGAGCCCTGGGGGGGACCGG - Intergenic
1183312526 22:37118405-37118427 TGCTGAGGCAGGGCTGGGACTGG + Intergenic
1184058853 22:42069966-42069988 AACTGAGGCCCGAGGGGGAAAGG - Intronic
1184155531 22:42664236-42664258 TACTGAGGCCGGAGGGGCCTGGG + Intergenic
1184236930 22:43187474-43187496 GACTGGGGGCGGGGCGGGACGGG - Intergenic
1184745387 22:46452873-46452895 TACTGAGGCCTGGAGGGCACAGG - Intronic
949949560 3:9217877-9217899 CACAGAGGCAGGGAGGGGACAGG + Intronic
953590011 3:44242164-44242186 CCCTGAGGCCGGGGGGTGCCGGG + Exonic
953684977 3:45070537-45070559 GGCTGAGGCCGGGGGAGGCCTGG - Intergenic
956169217 3:66419542-66419564 TGCTGAGGCCAGGAGGAGACAGG + Intronic
957329462 3:78742842-78742864 TACTGATGGCGTGGGGGAACTGG + Intronic
958763485 3:98336401-98336423 TGCTGAGGGCTGGGGGGCACTGG + Intergenic
961551358 3:127672247-127672269 GACTGAGGCGGGGTGGGGAGAGG - Exonic
961749104 3:129085293-129085315 TACGGAGGCCGTGGTGGGTCGGG - Intergenic
962964207 3:140338560-140338582 TACTGAGGCCGGGGGGGGACTGG - Intronic
965640764 3:170826370-170826392 TACTGGGGGCGGGGGGAGATGGG + Intronic
968088077 3:195883129-195883151 TACTGCGGGCGGGAGGGGGCGGG - Intronic
968230193 3:197001315-197001337 TACTGAGGTGGGGGTGGGCCCGG - Intronic
968810844 4:2799100-2799122 TCCTGAGGCAGGGCGGGTACGGG - Intronic
968964677 4:3763937-3763959 TACTGGGGGCGTGGGGAGACAGG - Intergenic
968965002 4:3765397-3765419 AACTGAGGCCGGGGTGGGTGCGG + Intergenic
969231883 4:5837941-5837963 TACTGAGGGATGGGGGAGACTGG + Intronic
969438201 4:7200437-7200459 AACTGAGGCCTGGGGAAGACTGG - Intronic
969641623 4:8402189-8402211 CCCTGGGGCCGGGTGGGGACGGG + Intronic
969732626 4:8965594-8965616 TACAGATGCCGAGGGGGAACTGG - Intergenic
969839759 4:9872169-9872191 AACTGAGGCCAGAGAGGGACAGG + Intronic
977637867 4:99321647-99321669 TCCAGAGGCCGGGGGGGGGTGGG - Intergenic
982267841 4:153556107-153556129 TACTGGGGCCGGGGGGAGGTGGG + Intronic
985321476 4:188716536-188716558 TACTGAGGCCCAGAGAGGACAGG + Intergenic
986011247 5:3717696-3717718 TGCTGAGGGCGGGGGGAGAGAGG + Intergenic
986180248 5:5386334-5386356 TACTGGGGCCGGGGATGAACAGG - Intergenic
996405445 5:123098841-123098863 CACTGAAGCAGGGCGGGGACAGG - Intronic
999138988 5:149344981-149345003 TACTGAGGCGGGAGGGCAACAGG - Intergenic
1001316394 5:170644062-170644084 TACTGAGGGCAGAGGGGCACTGG - Intronic
1002447847 5:179301018-179301040 CACTGAGGCCAGGAGGGGGCTGG - Intronic
1002697470 5:181100585-181100607 TGCTGAGGTCGGCGTGGGACAGG + Intergenic
1006117074 6:31781159-31781181 CACTGAGGCCGGGGAAGGAGAGG - Intronic
1006446805 6:34084330-34084352 TCCTGAGGCCAGGGAGGGACAGG - Intronic
1007072928 6:39049535-39049557 TACAGAGGCTGGTAGGGGACGGG - Intronic
1007386047 6:41520889-41520911 TACTGAGGCCTGGGATGGGCAGG + Intergenic
1017713435 6:157190395-157190417 CACTGAGGCCAGCCGGGGACAGG - Intronic
1019423998 7:964627-964649 TCCTGAGGCCTGGGTGGAACAGG + Intronic
1024099455 7:46015524-46015546 TACTGAGGTCCTGGGGGGAGGGG + Intergenic
1026899111 7:74027529-74027551 TACAGAGGCCGGGGGGCTGCAGG - Intergenic
1027045056 7:74985691-74985713 CACTGAGGCCTGGGGGGTAATGG - Intronic
1029217427 7:98961335-98961357 TACTGAGGATGGCTGGGGACTGG - Exonic
1033654275 7:143362548-143362570 TACCGCGGCCGGGCGGGGGCAGG - Intronic
1034693013 7:153029063-153029085 TACTGAGACCAGGGAGGGGCGGG - Intergenic
1035412405 7:158655697-158655719 TCATGAGGCAGGGAGGGGACGGG - Intronic
1035727811 8:1835358-1835380 AGCTGAGGCCGTGGGGGTACAGG + Intronic
1036621707 8:10428259-10428281 TACTGCGGCCTTGGGGGCACCGG + Exonic
1039398316 8:37246631-37246653 TCCTGAGGCTGGGAGGAGACTGG - Intergenic
1040436824 8:47399194-47399216 TGCTGAGGCAGGGGAGGGAGGGG + Intronic
1049241173 8:141538040-141538062 AACTGAGGCCAGGCGGGGAGAGG + Intergenic
1049833058 8:144714236-144714258 TGCAGAGGCCGCGGGGTGACCGG + Intergenic
1054797406 9:69315597-69315619 TACTTAGGACTGGGGGGAACAGG - Intergenic
1056799507 9:89681420-89681442 TGCTGGGGCCCGGGGGGGGCGGG - Intergenic
1057201387 9:93142183-93142205 TCCTGTGGCAGGGAGGGGACAGG + Intergenic
1059333938 9:113556778-113556800 TACTGAGGCCAGAGAGGGGCAGG + Intronic
1060050697 9:120376276-120376298 TACTAAGCCCGGTGGGGGAAGGG + Intergenic
1061888721 9:133606449-133606471 TACAGAGGCCAGGGTGGGGCTGG - Intergenic
1061943977 9:133898179-133898201 AACTGAGGCCGGGCGGGCACAGG + Intronic
1062063793 9:134515047-134515069 TTCTGAGACCGGGGTAGGACGGG - Intergenic
1062485612 9:136773796-136773818 TCCTGAGGCCGAGGGGAGAGAGG - Intergenic
1190228115 X:48561096-48561118 TACTTAGGCCTGGGGAGGAAGGG - Exonic
1190244465 X:48682025-48682047 AACTGAGGCCTGGGGAGGCCGGG + Intronic
1190309511 X:49106815-49106837 AACTGAGGCCTGGGGAGGCCTGG + Intergenic
1192510912 X:71719831-71719853 TACTAAGGGCTGGGGGAGACAGG + Intergenic
1192515785 X:71761722-71761744 TACTAAGGGCTGGGGGAGACAGG - Intergenic
1200073484 X:153540187-153540209 CACTGAGGCCGGAGGTGGAGAGG - Intronic
1201622306 Y:15973528-15973550 TAGTGAGGGCGGCGGGGGGCGGG + Intergenic