ID: 962969486

View in Genome Browser
Species Human (GRCh38)
Location 3:140385675-140385697
Sequence GTTTAAGGTTAGAACATCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 98}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962969486_962969491 -5 Left 962969486 3:140385675-140385697 CCCCTGATGTTCTAACCTTAAAC 0: 1
1: 0
2: 0
3: 5
4: 98
Right 962969491 3:140385693-140385715 TAAACCAGCAATTTCAGAGCGGG 0: 2
1: 0
2: 1
3: 21
4: 282
962969486_962969494 16 Left 962969486 3:140385675-140385697 CCCCTGATGTTCTAACCTTAAAC 0: 1
1: 0
2: 0
3: 5
4: 98
Right 962969494 3:140385714-140385736 GGGCTTCTCTCTGCCTGAAGAGG 0: 1
1: 0
2: 2
3: 20
4: 223
962969486_962969490 -6 Left 962969486 3:140385675-140385697 CCCCTGATGTTCTAACCTTAAAC 0: 1
1: 0
2: 0
3: 5
4: 98
Right 962969490 3:140385692-140385714 TTAAACCAGCAATTTCAGAGCGG 0: 1
1: 0
2: 0
3: 10
4: 202
962969486_962969492 -4 Left 962969486 3:140385675-140385697 CCCCTGATGTTCTAACCTTAAAC 0: 1
1: 0
2: 0
3: 5
4: 98
Right 962969492 3:140385694-140385716 AAACCAGCAATTTCAGAGCGGGG 0: 1
1: 0
2: 0
3: 12
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962969486 Original CRISPR GTTTAAGGTTAGAACATCAG GGG (reversed) Intronic
905743877 1:40396408-40396430 ATTTAAAATTAGAAAATCAGAGG - Intronic
907478969 1:54730627-54730649 GCCTAAGGTTAGCACATGAGGGG - Intronic
908049747 1:60216288-60216310 GTTTATGATGAGAACATTAGAGG - Intergenic
909578554 1:77204733-77204755 GTCTAGTGTTAGAATATCAGGGG - Intronic
915670127 1:157481945-157481967 TTTTATTTTTAGAACATCAGAGG - Intergenic
917164834 1:172100156-172100178 GTCTAAAGTTAGAACAATAGTGG - Intronic
918845744 1:189609095-189609117 GTTTAAGGCCAGAATACCAGGGG + Intergenic
924394383 1:243603554-243603576 ATGTACAGTTAGAACATCAGTGG - Intronic
1074706262 10:116134855-116134877 TTTTAAGGTTTGCACAGCAGAGG - Intronic
1076494189 10:130886062-130886084 GTTCAAGGTCAGAGCATCACAGG - Intergenic
1081120253 11:39257020-39257042 GTCTTAGGCTAGAACATAAGAGG + Intergenic
1082902275 11:58267764-58267786 GTTTATGGTTTGATCATCACTGG - Exonic
1085076050 11:73593420-73593442 GTTTAAGGTTACACAGTCAGTGG - Intronic
1085553014 11:77392969-77392991 GTCTAAGGTTATAAAATTAGAGG - Intronic
1086011807 11:82113589-82113611 GTTTAGGAAGAGAACATCAGAGG - Intergenic
1092510330 12:9148644-9148666 GTGGAAGGTGAGAACATAAGGGG - Intergenic
1094678839 12:32649320-32649342 GTTCAAGAGAAGAACATCAGGGG - Intergenic
1101127073 12:101647021-101647043 GTTGAAGACTAGAACAGCAGAGG + Intronic
1109850103 13:68051895-68051917 GTAGAAAATTAGAACATCAGAGG + Intergenic
1110336719 13:74341067-74341089 GTTTAAGGATACAAAATCAATGG - Intergenic
1117746846 14:58878526-58878548 TTTTATGGTTAGGACATCAATGG - Intergenic
1127967852 15:63937082-63937104 GTCTGAGGTTAGAATATCAAAGG + Intronic
1131669979 15:94609183-94609205 GTTTATTGTTAGAAAATCTGAGG - Intergenic
1132377485 15:101339358-101339380 GTTTCAGTTTAAAACACCAGTGG + Intronic
1139245594 16:65439419-65439441 GTTTAAAGTTAGAGCATAAAGGG - Intergenic
1139536471 16:67578144-67578166 ATTTAATGTAAGAACATGAGGGG + Intronic
1143855670 17:9846645-9846667 GTTTAATGTTAGAATCTAAGTGG + Intronic
1153458166 18:5301792-5301814 TTTTAAGTTTAGTACATCAAGGG + Intergenic
1157110158 18:44813151-44813173 GTTTAAGTGTAGGACATCAGTGG - Intronic
1157671142 18:49529735-49529757 GTTTATGGTTATTACAACAGGGG + Intergenic
1158448268 18:57540073-57540095 GTTTCAGGTTAGAACAACTTGGG - Intergenic
1158875431 18:61729838-61729860 GCTTATGGGTAGAACATCAAAGG - Intergenic
1159426322 18:68292267-68292289 GTTTAATGGTAAAATATCAGGGG - Intergenic
1159638105 18:70830544-70830566 CCTTAAGGTTAGAAAACCAGAGG + Intergenic
925833412 2:7918615-7918637 GTTAAATGTTCGAACATCAGTGG + Intergenic
928923751 2:36554782-36554804 GTTTAAGAAAAGACCATCAGAGG + Intronic
932395858 2:71447206-71447228 ATTTGAGGTTTGAACAACAGAGG - Intergenic
933493903 2:83023342-83023364 GGTTAAGCTTTGAATATCAGTGG - Intergenic
935505103 2:103890732-103890754 GTTTAAGATTACACCACCAGGGG + Intergenic
939681164 2:145134935-145134957 CTTTAAGGTTAGGAGATAAGAGG + Intergenic
940390076 2:153122490-153122512 CATTAAGGTTAGCACATCAAAGG - Intergenic
941094656 2:161223908-161223930 GTTTAAGGTAAGAAGACAAGAGG + Exonic
944827578 2:203500980-203501002 TTTTAAGGTTAGAACAGCATAGG - Intronic
947564107 2:231183000-231183022 GTTTCAGGCTACATCATCAGTGG - Intergenic
1169588288 20:7112079-7112101 GTTTAAGGATGGAAGATGAGAGG + Intergenic
1170543276 20:17410369-17410391 GTTCAAGGGTAGAGCCTCAGTGG + Intronic
1174808134 20:53622368-53622390 GTTTCTGGTTAGGCCATCAGTGG + Intergenic
1175619186 20:60428979-60429001 GTCCAAGATTAGAACATAAGGGG - Intergenic
1177514681 21:22133947-22133969 GTTTCAAATTAGAACACCAGTGG - Intergenic
953724263 3:45383782-45383804 ATTTAAAGGTAGAACATTAGAGG + Intergenic
957384055 3:79472279-79472301 GTTTAGGATTAGAAATTCAGAGG + Intronic
959744110 3:109756691-109756713 GTTTAAGGATAGAGCATCTTAGG + Intergenic
960921558 3:122752080-122752102 GATTAAGCTTAACACATCAGAGG + Intronic
961665472 3:128491233-128491255 GTTTAAAGTTAGCTCATCCGAGG + Intronic
961816554 3:129553616-129553638 GTTTAAGGATGCTACATCAGGGG + Intergenic
962969486 3:140385675-140385697 GTTTAAGGTTAGAACATCAGGGG - Intronic
963198302 3:142558646-142558668 GCTTAATGTTAGAAGATTAGCGG + Exonic
964553522 3:157910993-157911015 GTATAGGGTGAGAAAATCAGTGG + Intergenic
969207430 4:5657249-5657271 GTTCAAGGTGAGGACAGCAGAGG - Intronic
975223304 4:71839607-71839629 TTTTAAAGCTGGAACATCAGTGG + Intergenic
977160134 4:93623714-93623736 ATTTAAGAATAGAAAATCAGTGG - Intronic
978061202 4:104342191-104342213 GATTAATTTTAGAACACCAGGGG + Intergenic
978977147 4:114891801-114891823 GGTTAAGGTTAGACCATGAAGGG - Intronic
983586103 4:169356547-169356569 GTTTGAGGTTAGATTATCAATGG + Intergenic
983735801 4:171058425-171058447 GTTTAAAGGTTTAACATCAGAGG - Intergenic
985348667 4:189035047-189035069 GTTTAAGATCAGAACAGCAGAGG - Intergenic
986103545 5:4637300-4637322 GTTTAAGTTGAGATCCTCAGAGG + Intergenic
988579341 5:32455295-32455317 GTTTAAGTCTAGGACACCAGTGG - Intergenic
996193254 5:120571433-120571455 ATATAAGGTCAGAACATTAGAGG + Intronic
997466302 5:134090269-134090291 GTTTGGGGGCAGAACATCAGTGG - Intergenic
998595421 5:143524701-143524723 GTTTAAGGATAGAGCATGTGGGG - Intergenic
1001766215 5:174249201-174249223 GTTTAAGATCAGGGCATCAGTGG + Intergenic
1003337059 6:5183907-5183929 GTTTATGGTGAGAACATTCGAGG - Intronic
1003344604 6:5255688-5255710 GTTTAAGGTGAGAAAATTCGTGG - Intronic
1003344659 6:5256099-5256121 GTTTAAGGTGAGAAAATTAGTGG + Intronic
1005956459 6:30666822-30666844 CCTTAAGGGTAGAACAGCAGAGG - Intronic
1008355965 6:50553585-50553607 GTTTAGGGTTAGTACAGGAGGGG - Intergenic
1008916444 6:56792702-56792724 GATTCAGGTTAGAACATTTGTGG - Intronic
1011940385 6:92835495-92835517 GTTTGAAGCTAGAAGATCAGTGG + Intergenic
1012105508 6:95152459-95152481 TTTTAAGGGAAGAACATCTGAGG + Intergenic
1012991615 6:105932003-105932025 GTTTAAGGTTATAAATTCATTGG + Intergenic
1016254736 6:142090298-142090320 GTTTATGGCTAGATCATCATAGG - Intergenic
1017483205 6:154878753-154878775 ATTTCAGGTTATACCATCAGAGG - Intronic
1030322245 7:108181577-108181599 GTAGAATGTTAGATCATCAGTGG + Intronic
1030661680 7:112225317-112225339 GCTCAAGGTTAGAAGTTCAGTGG - Intronic
1031059504 7:117034424-117034446 ATTTAAAGACAGAACATCAGTGG + Intronic
1031269383 7:119627288-119627310 GTATAAGGTTAAAATCTCAGGGG + Intergenic
1034574715 7:151987038-151987060 TTTTAAAGTTAGAACTTCTGTGG + Intronic
1034952052 7:155305223-155305245 GGTTAGGCTTAGAACCTCAGAGG - Intronic
1035050646 7:155997020-155997042 GTTTGAGATTAGAACGTTAGAGG - Intergenic
1036503035 8:9330803-9330825 GTCTTAGCTAAGAACATCAGAGG - Intergenic
1044000652 8:86875682-86875704 GTTTAATGTTGAAACACCAGAGG - Intronic
1045067053 8:98458537-98458559 GTCTTAGGTTACAAAATCAGTGG - Intronic
1045410668 8:101914384-101914406 GATTAAGGTTAAATCAGCAGTGG - Intronic
1051956289 9:22698775-22698797 CTTTAAGCTAAGACCATCAGGGG + Intergenic
1186155894 X:6726110-6726132 GTAGCAGGTTTGAACATCAGTGG + Intergenic
1189787373 X:44571557-44571579 GTACAAGTTTAGAACATGAGGGG + Intergenic
1189905470 X:45754776-45754798 CTTTAATCTTAGAAAATCAGGGG - Intergenic
1190712496 X:53080870-53080892 GGTTAAGGTTACAAAATGAGGGG + Intergenic
1191059815 X:56283272-56283294 GTGTAAGGTTAGAAACTCAAGGG - Intronic
1192598090 X:72432590-72432612 ATTTAAGGCCAGAACTTCAGGGG - Intronic
1194065651 X:89258267-89258289 GTTTAATGTTAGAACTTAAAAGG - Intergenic
1197344071 X:125310726-125310748 GTGTAAAGTGAGAAGATCAGAGG + Intergenic
1200719819 Y:6592398-6592420 GTTTAATGTTAGAACTTAAAAGG - Intergenic