ID: 962973310

View in Genome Browser
Species Human (GRCh38)
Location 3:140424872-140424894
Sequence CTGTGGTAGGGGAGGGTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2907
Summary {0: 1, 1: 2, 2: 7, 3: 151, 4: 2746}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962973310 Original CRISPR CTGTGGTAGGGGAGGGTGGG TGG Intronic
Too many off-targets to display for this crispr