ID: 962977542

View in Genome Browser
Species Human (GRCh38)
Location 3:140458660-140458682
Sequence CTATAATAGTACTCAGGCTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 66
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 61}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962977542 Original CRISPR CTATAATAGTACTCAGGCTA AGG (reversed) Intronic
907106408 1:51887009-51887031 CTAAAATAGTACTCATGGTCAGG + Intergenic
916173457 1:162019448-162019470 CTATAATGGTCCTTAGGGTAGGG - Intronic
923206780 1:231766917-231766939 CCATAATAGTATTCTGACTAAGG + Intronic
1088421351 11:109651174-109651196 CTTTAAAAGTACTCATGCTTAGG - Intergenic
1092815830 12:12311564-12311586 CTATAATAGGACTTAGGCAGCGG - Intergenic
1112102982 13:96210470-96210492 CTTTAATTCTACTAAGGCTATGG - Intronic
1114137055 14:19865213-19865235 CTGTATTTATACTCAGGCTAAGG + Intergenic
1128982994 15:72199825-72199847 CTAGTTCAGTACTCAGGCTATGG - Intronic
1131623744 15:94096194-94096216 CTATAACAGTACCCAGCCCACGG + Intergenic
1149005038 17:51796535-51796557 CTAAAAAAGTACTAAGACTAGGG - Intronic
1156978573 18:43257455-43257477 CTATAAAAGGAATCACGCTAAGG - Intergenic
1157427278 18:47594683-47594705 CAATCATAGTTCTCAGTCTAAGG + Intergenic
1164442809 19:28292172-28292194 CTGTGATAGTACCCAGGCTCTGG + Intergenic
925857470 2:8144061-8144083 TTAAAATAGTACTCAGCCAAGGG - Intergenic
927616288 2:24600042-24600064 ATATAATAGGACTAAGGCTTAGG - Intronic
928944407 2:36759886-36759908 CTATACTATTACTCTGGCTGAGG + Intronic
930991892 2:57666181-57666203 TTATAATACTAGTGAGGCTAGGG + Intergenic
932394824 2:71435849-71435871 CTGTAATTTTACTCAGGCTGTGG - Intergenic
935388835 2:102529570-102529592 TTATAATAGTGATCAGGATAAGG + Intronic
939383045 2:141460882-141460904 CTATAATAGTTCTCAGGGGTGGG + Intronic
941624530 2:167816498-167816520 CTATAATAATACCTAGGATAGGG + Intergenic
945223515 2:207508290-207508312 CTATACTGGTTCTCACGCTATGG - Intergenic
1169029886 20:2398775-2398797 CTATCACAGGCCTCAGGCTATGG + Intronic
1177216432 21:18135749-18135771 CAATAATAGTACCCAAGCCATGG + Intronic
1178230290 21:30775990-30776012 CTGTAATACAACTCTGGCTATGG - Intergenic
1179400891 21:41082095-41082117 CTAGAATAGTACTCTGTCAAAGG + Intergenic
1179427994 21:41296793-41296815 CCAAAATAGTGCTCAGGCTGAGG + Intergenic
951959071 3:28294878-28294900 TTATATTAGAACTCAGGCTTTGG + Intronic
953262979 3:41358255-41358277 CTATAATTGTACTAGGGATATGG - Intronic
953946827 3:47156563-47156585 CTATCCTAGTGCTTAGGCTAGGG - Intronic
954594236 3:51811756-51811778 CTATAAAATTACCCAGTCTAGGG - Intergenic
954982883 3:54761929-54761951 CTAAAATAGGGCTCAGGGTAAGG - Intronic
962947998 3:140189891-140189913 TTATAAGCTTACTCAGGCTATGG - Intronic
962977542 3:140458660-140458682 CTATAATAGTACTCAGGCTAAGG - Intronic
971562207 4:28093956-28093978 CTATAAAATAACTCAGGCTCAGG - Intergenic
972117784 4:35659208-35659230 CTTTAATAGTAGTAAGGTTAGGG - Intergenic
973340413 4:48997634-48997656 CTAAAATTGTCCTCAGGCTCTGG - Intronic
976804051 4:89026074-89026096 CTAGAATAGTATTCTGGTTATGG - Intronic
977452863 4:97221408-97221430 CTATTATAGTACACAGACTAAGG + Intronic
979137870 4:117132386-117132408 CTATAATAGTACTCATCATATGG + Intergenic
988458523 5:31410845-31410867 GAATAATAGAACTCAGGCCAAGG - Exonic
994520603 5:100829450-100829472 CTAAAATAGAATTCAGGCAAAGG - Intronic
996030057 5:118694820-118694842 GTATAATTGTACTTAGGCAATGG - Intergenic
996494702 5:124140457-124140479 CCAGAATAGTATTCAGTCTAGGG - Intergenic
1007903199 6:45431172-45431194 ACATAATAGAACTGAGGCTAAGG + Intronic
1008602224 6:53107423-53107445 CTAGAGTAGCACTCAGGCTTTGG + Intergenic
1008731907 6:54492542-54492564 CTAAATTAGGACTCAGTCTATGG - Intergenic
1009972970 6:70644384-70644406 ATATAAAAGTACTCAGTCTCTGG - Intergenic
1013552005 6:111217094-111217116 CTCCAATAGCAGTCAGGCTAGGG - Intronic
1017849785 6:158295271-158295293 CTATTTTAGTTCTCAAGCTAAGG - Intronic
1021242242 7:18217910-18217932 CTAAAGTAGTAGTCAGGCTGTGG + Intronic
1023014142 7:35949815-35949837 CTAACATAGTACTCAGTGTAAGG - Intergenic
1027253659 7:76415827-76415849 CTATAATAAAAAGCAGGCTAGGG + Intronic
1028600482 7:92595361-92595383 CAATAATAGTACTCAACCTGGGG - Intergenic
1032907601 7:136388461-136388483 CTGTAATTGTCCTCAGGTTACGG - Intergenic
1038202861 8:25431270-25431292 CTATAAAAATACTAGGGCTAGGG - Intronic
1043943133 8:86219082-86219104 GTAGAATAGCACTAAGGCTAAGG - Intronic
1044681284 8:94780387-94780409 CTATAATAGGTCTCAGCTTATGG + Exonic
1046004758 8:108465125-108465147 CTATAATATTACTCAGAATAGGG - Intronic
1046246994 8:111577057-111577079 ATATAATAGAACTCAGGCAAAGG - Intergenic
1050466784 9:5934903-5934925 ATGTAATAGTACTTAGACTAAGG - Intronic
1051594618 9:18811592-18811614 CTATAAAACCACTCAGGCTTGGG - Intronic
1052715665 9:32113876-32113898 GTATAAAAGTGCTCAGCCTATGG - Intergenic
1060262355 9:122087523-122087545 CTATAATAGATCTCAGGACAGGG + Intronic
1190624153 X:52320250-52320272 CTGAAATAGTGCTCAGTCTAGGG + Intergenic
1195086678 X:101419930-101419952 TTATAATAGTACTCAAAATATGG + Intronic