ID: 962979660

View in Genome Browser
Species Human (GRCh38)
Location 3:140476481-140476503
Sequence ACGTACTCCAAGAGGGTAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 60
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 55}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962979654_962979660 29 Left 962979654 3:140476429-140476451 CCACATCTCTCATCTGAGAAGTG 0: 1
1: 0
2: 3
3: 33
4: 297
Right 962979660 3:140476481-140476503 ACGTACTCCAAGAGGGTAAAAGG 0: 1
1: 0
2: 0
3: 4
4: 55
962979656_962979660 0 Left 962979656 3:140476458-140476480 CCTTGCATATGACCTCAAAACAT 0: 1
1: 0
2: 0
3: 13
4: 152
Right 962979660 3:140476481-140476503 ACGTACTCCAAGAGGGTAAAAGG 0: 1
1: 0
2: 0
3: 4
4: 55

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962979660 Original CRISPR ACGTACTCCAAGAGGGTAAA AGG Intronic
912606388 1:110993575-110993597 AGGTACCCAAAGAGGGTAAAGGG - Intergenic
915348939 1:155212776-155212798 TCTGACTCCAAGAGGGTAATGGG + Intronic
915352126 1:155233402-155233424 TCTGACTCCAAGAGGGTAATGGG + Intergenic
917216090 1:172679456-172679478 ACGTGCTCTAAGAGGCAAAACGG - Intergenic
1063518306 10:6718189-6718211 ATGTAATCCAATCGGGTAAATGG + Intergenic
1067997589 10:51291920-51291942 AAGTACTCCAAGACTGTTAAAGG - Intronic
1068105807 10:52614256-52614278 AGTAATTCCAAGAGGGTAAAGGG + Intergenic
1068568216 10:58599034-58599056 ACGTCCACCAACAGTGTAAAAGG - Intronic
1071383854 10:85100142-85100164 ACCTACTCCAAAAGGGTCAGTGG + Intergenic
1075126280 10:119702358-119702380 ACGGACCCTAAGAGGGTAAAGGG - Intergenic
1076981392 11:206880-206902 ACGGGCTCCAGGAGGGGAAATGG + Intronic
1081828368 11:46081305-46081327 ACATATTCCAAGAGTTTAAAGGG + Intronic
1083143616 11:60741063-60741085 ATGAACTCCAGGAGGGCAAAGGG - Exonic
1083999716 11:66289472-66289494 ACGTACTCCAGGAGGGAACGGGG + Intergenic
1086904904 11:92407156-92407178 AGGTACTACAAGAGGGTAGTGGG + Intronic
1091651642 12:2314554-2314576 AAGTACAACAAGAGGGGAAATGG - Intronic
1093434519 12:19121252-19121274 ACATTCACTAAGAGGGTAAATGG + Intergenic
1115961776 14:38842052-38842074 ATGCCCTCCAAGAGGGCAAATGG - Intergenic
1122024879 14:98868425-98868447 AACTACTCCAGGAGGGGAAATGG + Intergenic
1125142481 15:36425099-36425121 ACGTACTCCAAAAAAGTAATCGG - Intergenic
1135671487 16:24379362-24379384 ACGAAATCTAAGAGGGTAGAGGG + Intergenic
1138999924 16:62497488-62497510 ACGCACTCCAAGTGGGGATAAGG - Intergenic
1154173765 18:12068396-12068418 ACGTACGCCAAGAGGGGCAAGGG - Intergenic
1158876748 18:61741419-61741441 ACGTAAGCCAAGAGGGTAGGGGG + Intergenic
1163797234 19:19344689-19344711 ACGTCCACCATGAGGGCAAAGGG - Intronic
1167500222 19:49842210-49842232 ATGCACTCTAAGAAGGTAAAAGG + Intergenic
928431514 2:31222699-31222721 ACCTAGTCCAAGGGGTTAAAAGG - Intronic
928443698 2:31314680-31314702 CCATACTCCAAGAGGGCACAGGG + Intergenic
930975056 2:57447683-57447705 ACTTGCTCCAAAAGGGTAGATGG - Intergenic
940378441 2:152985669-152985691 AAGTAATCCAAGAGGGAAAGAGG - Intergenic
944861144 2:203817055-203817077 AAGTAATCCAAGAGGCTAATTGG + Intergenic
1181884630 22:26010428-26010450 ACATACTTCAAGAAAGTAAAGGG + Intronic
955374894 3:58386673-58386695 CCTTACTCCAAGAGGGTATAAGG - Intronic
961755618 3:129125528-129125550 ACCTCCTCCAAGTGGCTAAAGGG + Intronic
962979660 3:140476481-140476503 ACGTACTCCAAGAGGGTAAAAGG + Intronic
970496897 4:16635337-16635359 ACTTACACCAAGATAGTAAATGG + Intronic
975658361 4:76663897-76663919 ACAGAGACCAAGAGGGTAAATGG - Intronic
979326753 4:119389368-119389390 AAGAACTCCAAGAGGGTGACGGG + Intergenic
983244624 4:165274014-165274036 AAGAACTCCAAGAGGGTGACAGG + Intronic
997000905 5:129760861-129760883 AGGTTTTCCAGGAGGGTAAAAGG + Intronic
1002579467 5:180198953-180198975 AAGGACTCCCAGAGGGTAGAAGG + Intronic
1004527602 6:16424005-16424027 AAGTGCTCCAAGGGGTTAAAAGG - Intronic
1007993764 6:46284446-46284468 ATGAACTCCAAAATGGTAAAAGG + Intronic
1010261791 6:73825388-73825410 AAGAACTCCCAGAGAGTAAAGGG - Exonic
1011004051 6:82624019-82624041 ACGTATACCAAGTGGGTATACGG - Intergenic
1028074190 7:86491007-86491029 ACTTTCTCTAGGAGGGTAAATGG + Intergenic
1032537891 7:132679575-132679597 ACCTACACCTAGATGGTAAAGGG - Intronic
1035152018 7:156882573-156882595 ACAGACTCAAAGAGTGTAAATGG + Intronic
1038514680 8:28176685-28176707 ACAGACTTCAAGAGGGAAAATGG - Intronic
1038927422 8:32156146-32156168 AGGAACTCAAAGAGGGCAAAAGG - Intronic
1045819103 8:106314175-106314197 ACATACTCCTAGAGGAAAAAAGG - Intronic
1050232490 9:3541720-3541742 ACTTACTTCAAGTGGATAAATGG - Intergenic
1060725151 9:126001462-126001484 ACCCACTCCAGGAGGGCAAAGGG + Intergenic
1185889985 X:3815061-3815083 AAGTACGCCAATGGGGTAAAGGG - Intergenic
1187508939 X:19900273-19900295 AAATACTCCAAAAGGTTAAAAGG + Intergenic
1187732569 X:22270808-22270830 ACTGAGTCCAAGAAGGTAAATGG - Intergenic
1188080197 X:25829368-25829390 AAATACTCCAAGTGGGGAAAAGG - Intergenic
1188592047 X:31849493-31849515 ATGTATTCCAAGAGGGAACATGG + Intronic
1194189987 X:90823311-90823333 AACTACTACAAGAGGGAAAAAGG - Intergenic
1197587706 X:128370049-128370071 AATTACTCCAAAAGGCTAAAAGG + Intergenic