ID: 962981305

View in Genome Browser
Species Human (GRCh38)
Location 3:140492878-140492900
Sequence AAACTGCCCCCGCAGGAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 123}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962981303_962981305 -8 Left 962981303 3:140492863-140492885 CCAGAATCTGCAGACAAACTGCC 0: 1
1: 1
2: 1
3: 13
4: 170
Right 962981305 3:140492878-140492900 AAACTGCCCCCGCAGGAGACAGG 0: 1
1: 0
2: 0
3: 3
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962981305 Original CRISPR AAACTGCCCCCGCAGGAGAC AGG Intronic
904263249 1:29303346-29303368 GAACTGCCTGCGCAGGAGAAAGG + Intronic
904598195 1:31659694-31659716 ACACTTCCACCCCAGGAGACTGG - Intronic
905280515 1:36846220-36846242 AAACAGCAGCAGCAGGAGACTGG - Intronic
905480644 1:38259571-38259593 AAACTGCCCTCTAAGGAGAGTGG + Intergenic
907368610 1:53982612-53982634 AAACTTCCCCCGCAGGCAGCTGG - Intergenic
916454119 1:164953050-164953072 AAACTGGCACTGCAGGAGCCAGG + Intergenic
919115534 1:193276187-193276209 ACACTGCTCCTGCAGGACACGGG - Intergenic
919814656 1:201429844-201429866 AAACTGCCCCAGCAGGCCCCAGG - Intronic
920035500 1:203062608-203062630 AAACCCCACCAGCAGGAGACTGG + Intronic
924394773 1:243607064-243607086 ACTCTGCCCCTGCAGCAGACTGG - Intronic
1063290708 10:4744137-4744159 AAAGTGCCCGTGTAGGAGACTGG + Intergenic
1065497620 10:26345888-26345910 AAACTGCCTCATCAGGAGAATGG + Intergenic
1071261175 10:83920474-83920496 AAAATGCCCCCACAGGACAAAGG - Intergenic
1079791843 11:24748404-24748426 AAACTGCTCCCGCAGAACCCAGG - Intronic
1082315843 11:50719993-50720015 AAACTGCTCCATCAGGAGAAAGG + Intergenic
1085181428 11:74540167-74540189 TAAATGCCCCAGTAGGAGACCGG + Intronic
1087123840 11:94603261-94603283 AAACTCGCCCAGCAGGTGACAGG - Intronic
1087504776 11:99005547-99005569 AAACTTTCCCCACAGGGGACAGG + Intergenic
1089121313 11:116137625-116137647 AAACTGGGCCCAAAGGAGACGGG - Intergenic
1090299907 11:125626258-125626280 AAACTGCCCCCAGAGGCGAAAGG - Intronic
1094211818 12:27901167-27901189 AAAATGCACCCGGAGGAGACTGG + Intergenic
1097756709 12:63415481-63415503 AGACTGCCCCTGGAGGAGAATGG - Intergenic
1098204963 12:68098987-68099009 AAACTTCCTCCACAAGAGACAGG - Intergenic
1102458242 12:113084223-113084245 ACACTGACCCCTCAGGGGACAGG - Intronic
1103563263 12:121803637-121803659 AAACTGCCCGGGCCGGAGGCGGG - Intergenic
1106505070 13:30364072-30364094 AAACTGCCACCGCAGGGATCTGG + Intergenic
1106574862 13:30965095-30965117 AAACTGCCCATACAGAAGACAGG - Intronic
1106665246 13:31845193-31845215 AAACTGTCCCCTCAATAGACTGG + Intergenic
1112035509 13:95493029-95493051 GGACTGCCCCTGCAGGACACAGG - Intronic
1113453024 13:110425717-110425739 AACCTGCCTCTGCAGGACACGGG - Intronic
1115680183 14:35730018-35730040 AAACTGCTCCTGCAGGACCCAGG + Intronic
1117675661 14:58152354-58152376 AAGCCGCCCCCGCGGGAGAGCGG - Intronic
1120398278 14:83995848-83995870 AAAGTGTCCCCACAGGAGAGTGG - Intergenic
1121739308 14:96240325-96240347 AAACTGGTCCAGAAGGAGACAGG - Intronic
1123034244 14:105465422-105465444 AGGCTGGCCCCGCAGAAGACAGG - Intronic
1123479520 15:20618027-20618049 AATCTCACCCCGAAGGAGACAGG - Intergenic
1123638487 15:22382337-22382359 AATCTCACCCCGAAGGAGACAGG + Intergenic
1124341365 15:28891363-28891385 AATGGGCCCCAGCAGGAGACAGG - Intronic
1124843321 15:33264917-33264939 AAACTGCCCCCACATGAGAATGG + Intergenic
1124965748 15:34432358-34432380 AATGGGCCCCAGCAGGAGACAGG + Intronic
1127900835 15:63339663-63339685 AAAATGGCTCCCCAGGAGACGGG - Intronic
1129035725 15:72647386-72647408 AATCTGCACCTGCAGGAGATCGG - Intergenic
1129399850 15:75275539-75275561 AATCTGCACCTGCAGGAGATCGG - Intronic
1129667130 15:77585413-77585435 AAGCTGCCCCCATAGGTGACAGG - Intergenic
1133561119 16:6951269-6951291 AAACTGACCCCTCAGAAGATGGG - Intronic
1136622873 16:31442092-31442114 AAACGGCTCCAGCAGGAGAATGG + Intronic
1140113999 16:72026118-72026140 AAAGTGACCCCGCAGGGGTCTGG - Intronic
1143869340 17:9947005-9947027 AGAATGACCCCGCTGGAGACTGG + Intronic
1145211064 17:21013363-21013385 AAAGTGACACCGCAGGACACAGG + Intronic
1147989966 17:44326630-44326652 ACACTGCCTCCCCGGGAGACAGG + Intergenic
1149509448 17:57226933-57226955 AAACTGCCCACGAAGGATAAAGG - Intergenic
1151984264 17:77531967-77531989 AAACTGCCCTTGCAGGAGCTTGG + Intergenic
1153966069 18:10182804-10182826 AAACTGCTCCTGCAGGACCCAGG - Intergenic
1156496426 18:37528677-37528699 AAACTGCACCTTCTGGAGACTGG + Intronic
1157712808 18:49861664-49861686 AAACTGCCCCAGCCTGAGTCAGG + Intronic
1164607310 19:29609485-29609507 AAACAGCCCAGCCAGGAGACAGG + Intronic
1167078638 19:47264535-47264557 AAGCTGCCGGTGCAGGAGACGGG - Intronic
1167701780 19:51052488-51052510 AAAATGCCCCCTCAGGACAGTGG + Intergenic
1168147890 19:54429924-54429946 AACCTGACCCAGGAGGAGACAGG + Exonic
1168168909 19:54573715-54573737 CAACTGCCCTCTCAGGAGCCTGG - Intronic
925353793 2:3223045-3223067 AAACTGCCCAAGCCTGAGACTGG + Intronic
926097223 2:10089510-10089532 AGACAGCCCTCGCAGGACACTGG + Intergenic
926195130 2:10759100-10759122 TAAATGCCCCCGGAGGAGATAGG - Intronic
927324627 2:21790004-21790026 AAACTGCTCCCATATGAGACAGG - Intergenic
930155126 2:48099035-48099057 AAACTACACCAGCAGGTGACTGG - Intergenic
935413937 2:102795486-102795508 AAACTGCCACCACAGAAGAAAGG - Intronic
935756984 2:106283919-106283941 AAACTCCCACAGGAGGAGACAGG + Intergenic
936112580 2:109677117-109677139 AAACTCCCACAGGAGGAGACAGG - Intergenic
941206495 2:162579624-162579646 AAACTGCCCCTGCAGCAAAAGGG + Intronic
946406699 2:219495790-219495812 AAGCTGCCCCAGCAGGAAGCTGG + Intronic
947527387 2:230886895-230886917 AGCCTGGCCCCGCAGGAGCCAGG + Intergenic
947577713 2:231289688-231289710 CAACTGGTCCCGCAGGAGCCTGG + Intronic
947665901 2:231905151-231905173 ACCCTGCCCCCTCAGCAGACAGG + Intergenic
1169214560 20:3785750-3785772 AAGCTGCCCCCGCTGGTGGCCGG - Exonic
1173450578 20:43160042-43160064 AAAAGGCCCCTGCAGGAAACAGG + Intronic
1176340759 21:5693102-5693124 GAACAGCCCCCGCAGGATAGTGG + Intergenic
1176473013 21:7125255-7125277 GAACAGCCCCCGCAGGATAGTGG + Intergenic
1176504068 21:7631354-7631376 GAACAGCCCCCGCAGGATAGTGG - Intergenic
1177222681 21:18215305-18215327 AAACTTCCACCTCAGGAGATAGG + Intronic
1178697468 21:34807033-34807055 AAGCTTCCACCTCAGGAGACTGG + Intronic
1179902343 21:44400686-44400708 TAACTGCCCACGCCGCAGACTGG - Intronic
1180953080 22:19729539-19729561 AAAAGGCCCCAGCAGGAGATAGG + Intergenic
1182623410 22:31630112-31630134 AAACTTCCCAAGTAGGAGACGGG + Intronic
1184045838 22:41971727-41971749 AGTGTGCCCCCACAGGAGACGGG + Intergenic
1203240024 22_KI270733v1_random:7560-7582 GAACAGCCCCCGCAGGATAGTGG + Intergenic
950638771 3:14334424-14334446 AGGCTGCCCCCCCAGGAGCCAGG + Intergenic
951572351 3:24077918-24077940 ATACTGCTCCCGCAGGACCCAGG - Intergenic
960919131 3:122728931-122728953 CAGCTGCCACTGCAGGAGACAGG + Exonic
962981305 3:140492878-140492900 AAACTGCCCCCGCAGGAGACAGG + Intronic
963522695 3:146375242-146375264 CAACTGCCTCAGAAGGAGACAGG + Intergenic
964917609 3:161855183-161855205 AGACTGCTCCTGCAGGAGCCGGG - Intergenic
966992140 3:185243219-185243241 AGACTGCTCCTGCAGGACACAGG - Intronic
968921622 4:3525111-3525133 AAACTGACCTCGGAGGAGGCTGG + Intronic
976783134 4:88784149-88784171 AGACTTCCCTCGGAGGAGACAGG - Intronic
979100369 4:116604628-116604650 ATACTGCCACCGCTGGGGACTGG + Intergenic
986418536 5:7552966-7552988 AAACTGGCCACTCAGGGGACAGG + Intronic
988197424 5:28023171-28023193 AAACTTCCCCAGCAGAAGGCAGG + Intergenic
988795849 5:34653165-34653187 AAACTGCCCCTGCAGGAGGAAGG - Intergenic
995468347 5:112474345-112474367 AAAGTGCCCCTGGAGGAGATGGG - Intergenic
1000028364 5:157379872-157379894 AAGCTGGCCATGCAGGAGACTGG + Intronic
1003321365 6:5054922-5054944 AAATTTCCCCCACAAGAGACAGG - Intergenic
1006558313 6:34888079-34888101 AAAATGACCCCTCAGGAGAGCGG - Exonic
1011789871 6:90886160-90886182 AAACTGCTCCTGCAGGACCCGGG - Intergenic
1013852760 6:114535287-114535309 AGACTGCTCCTGCAGGACACAGG - Intergenic
1014203513 6:118630039-118630061 AAACTGCATCCTCAGGTGACTGG - Intronic
1017042123 6:150316027-150316049 AGACTGCCCCACCAGGAGTCAGG - Intergenic
1018743543 6:166747822-166747844 AAACGACCTCTGCAGGAGACAGG + Intronic
1018797245 6:167196110-167196132 AAAGTGGCCCCGGAGGTGACAGG - Intronic
1018819052 6:167358654-167358676 AAAGTGGCCCCGGAGGTGACAGG + Intronic
1019816194 7:3202504-3202526 AAACTGCCAGCTCAGAAGACAGG + Intergenic
1034280052 7:149847286-149847308 AAACTGCCTGCCCAGGAGATAGG + Intronic
1035202599 7:157276930-157276952 AAACAGTCCCCCCAGTAGACAGG - Intergenic
1040967626 8:53100446-53100468 AAACTGTCCCCTCAGGCCACGGG - Intergenic
1043812959 8:84765379-84765401 ACCCTGCCCCAGCAGCAGACAGG - Intronic
1049313408 8:141946142-141946164 AAGCTGCCCCCGCAGTGCACAGG - Intergenic
1052213599 9:25937690-25937712 CATCTGCCTCCGCAGGACACAGG - Intergenic
1061034104 9:128103858-128103880 AAACTGGCCCCCCAGGGGTCTGG - Intronic
1061489978 9:130939339-130939361 AAACTGCCCCCGGCGCAGCCTGG - Intergenic
1203422308 Un_GL000195v1:4891-4913 GAACAGCCCCCGCAGGATAGTGG - Intergenic
1203399097 Un_KI270519v1:64962-64984 AAACTGCTCCCTCAAGAGATTGG - Intergenic
1191151940 X:57228504-57228526 AGACTGCTCCTGCAGGACACGGG - Intergenic
1197168534 X:123406178-123406200 AAACTGCCCATGCAGTAAACCGG + Intronic
1199542873 X:148976992-148977014 AACCTTCCCCCGCAGAACACTGG - Intronic
1200001152 X:153060356-153060378 AAACGGCCACCACAGGACACAGG - Intronic
1200034188 X:153317764-153317786 AAATTGCCACCACAGGACACAGG + Intergenic
1200044776 X:153395723-153395745 AAACAGCCACCACAGGACACAGG + Intergenic
1200094528 X:153650928-153650950 AAACTACCGCCGGAGGAGATGGG + Exonic