ID: 962981305

View in Genome Browser
Species Human (GRCh38)
Location 3:140492878-140492900
Sequence AAACTGCCCCCGCAGGAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 123}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962981303_962981305 -8 Left 962981303 3:140492863-140492885 CCAGAATCTGCAGACAAACTGCC 0: 1
1: 1
2: 1
3: 13
4: 170
Right 962981305 3:140492878-140492900 AAACTGCCCCCGCAGGAGACAGG 0: 1
1: 0
2: 0
3: 3
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962981305 Original CRISPR AAACTGCCCCCGCAGGAGAC AGG Intronic