ID: 962982254

View in Genome Browser
Species Human (GRCh38)
Location 3:140501147-140501169
Sequence GAGAACAAGAGCAAGGTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 698
Summary {0: 1, 1: 0, 2: 8, 3: 66, 4: 623}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962982254 Original CRISPR GAGAACAAGAGCAAGGTGGG TGG (reversed) Intronic
900188041 1:1342160-1342182 TGCAACAAGAGCAGGGTGGGTGG + Intronic
900284736 1:1893689-1893711 CAGAACAAGGGCAGGGTGCGAGG + Intergenic
900410352 1:2509835-2509857 GAGAACAGGTGCAGGGTGCGGGG + Intronic
901175328 1:7294586-7294608 CTGAACGAGAGCAAAGTGGGTGG - Intronic
901813293 1:11779715-11779737 GAGAGGAAGAGAAAGGAGGGTGG + Intronic
903561853 1:24233953-24233975 GAAAAAGAGAGCAAGGGGGGAGG + Intergenic
903691498 1:25177148-25177170 GAGGAAGAGAGCAAAGTGGGAGG + Intergenic
904966238 1:34376534-34376556 GAAACCAACAGCAAAGTGGGAGG - Intergenic
905371793 1:37486376-37486398 GAGCCCAAGGGCAAGGTTGGGGG - Intergenic
905556774 1:38891968-38891990 GAAAACAAGAGCAAAGGTGGGGG - Intronic
907273728 1:53305554-53305576 GAGAAAAAGGTCAAGGCGGGTGG + Intronic
907686284 1:56615057-56615079 GGGAATAAGAGGAAGGTTGGAGG - Intronic
907940001 1:59078389-59078411 GAAAGAAAGAGCAAGGTTGGGGG - Intergenic
908801655 1:67886665-67886687 AAGAACAATTGCTAGGTGGGAGG + Intergenic
909477676 1:76099203-76099225 AAGAGAAACAGCAAGGTGGGAGG - Intronic
910460744 1:87445702-87445724 GAGAGAGAGAGCAAAGTGGGAGG + Intergenic
910619453 1:89236585-89236607 GAGAACAAGAAAAAGCAGGGTGG - Intergenic
910674395 1:89802096-89802118 AAAAACAAGAGAAATGTGGGAGG + Intronic
910852789 1:91665211-91665233 GATACCAGGAGCAAGGTGGTGGG + Intergenic
911720544 1:101186760-101186782 GAGAAAAAGAGGAGGGAGGGAGG - Intergenic
911741634 1:101392559-101392581 GAGGGCAAGAGGAAGGAGGGAGG - Intergenic
913414178 1:118587077-118587099 GAAAAAAAGAGGAAGGAGGGAGG + Intergenic
914496371 1:148201360-148201382 CAGAGCGAGAGCAAAGTGGGAGG - Intergenic
914687067 1:149989746-149989768 AAGAAGAAGAAGAAGGTGGGGGG + Intronic
914857562 1:151363652-151363674 GAGAGAGAGAGCAAGGGGGGAGG - Intergenic
916155701 1:161844794-161844816 GAAAACAATAGCAATTTGGGAGG - Intronic
916466833 1:165081384-165081406 GAGTGAAAGAGCAAGGAGGGAGG + Intergenic
916512255 1:165482672-165482694 GAAAAGAAGAGGAAGTTGGGGGG + Intergenic
916766633 1:167867105-167867127 GATACCAGGAGCAAGGTGGCGGG - Intronic
917499863 1:175576314-175576336 GAGAATTTGAGCAAGGTGGGAGG + Intronic
918096686 1:181341902-181341924 GTGAACAAGATAAAGGTGGGAGG + Intergenic
919537982 1:198812149-198812171 GAAAAGAAGAGCAAAGTTGGAGG + Intergenic
919950789 1:202361413-202361435 GAGAAAGAGAGAGAGGTGGGAGG + Intronic
919988720 1:202693957-202693979 AAGAGCCAGAGCAAGGTCGGGGG + Intronic
921232066 1:213083222-213083244 GTGAAAAACAGCAAGGTGTGTGG - Intronic
921443848 1:215221130-215221152 GAGGCCAAGGCCAAGGTGGGTGG + Intronic
921536019 1:216350083-216350105 GAAAGCAGGAGCAAAGTGGGAGG + Intronic
921812595 1:219531458-219531480 GAGAAGGACAGCAAGGTGAGAGG - Intergenic
921927320 1:220722177-220722199 GATACCAGGAGCAAGGTGGCAGG - Intergenic
922087782 1:222367742-222367764 GAGAGCAGGAGCAGGGCGGGTGG - Intergenic
922589681 1:226765348-226765370 GAGAGGGAGAGCAAAGTGGGAGG - Intergenic
922677177 1:227560334-227560356 GAGAGCAAGAGCAAGAGGGATGG - Intergenic
922715732 1:227870278-227870300 GAGAACAGCAGCAAAGTGGCGGG - Intergenic
922977964 1:229800909-229800931 GAGAACAGGAGCAAGGGGCAGGG - Intergenic
923341040 1:233007384-233007406 GAGAAAGAGAGTAAGATGGGTGG + Intronic
924147214 1:241088753-241088775 GAGAACAGGAGCACTTTGGGAGG + Intronic
924147335 1:241089747-241089769 GAGAACAGGAGCACTTTGGGAGG + Intronic
1063047008 10:2402089-2402111 GTGAACAGGAGCAAGGGGGATGG - Intergenic
1063101320 10:2952661-2952683 GAAAGTAAGAGAAAGGTGGGAGG + Intergenic
1063218746 10:3946923-3946945 AAGAAAAAAAGCAAGGAGGGAGG - Intergenic
1063636558 10:7788113-7788135 GAAGAAGAGAGCAAGGTGGGAGG + Exonic
1063650040 10:7925974-7925996 GAGGCCAAGGCCAAGGTGGGAGG + Intronic
1063712553 10:8493657-8493679 CAAAACAAGAGCAAGGTAGGAGG - Intergenic
1063847544 10:10147985-10148007 GAGAAGAAGAGAGAGTTGGGAGG - Intergenic
1065768442 10:29053912-29053934 GAGAACAAGAAGCAGGTGAGAGG + Intergenic
1065843730 10:29727797-29727819 GGGAACAAGTGCCAGGTGGGAGG + Intronic
1065931196 10:30480450-30480472 GATACCAGGAGCAAGGTGGTGGG - Intergenic
1066696094 10:38078801-38078823 CAGAGCAGGAGCAAGGTAGGAGG + Intergenic
1068224386 10:54087852-54087874 GAGAGCAGGACCAAGGAGGGTGG - Intronic
1069296509 10:66851607-66851629 GAGAGAAAGAGAGAGGTGGGTGG - Intronic
1069335007 10:67338277-67338299 GACAGCATGAGCAAGGTGTGGGG + Intronic
1070279085 10:75035838-75035860 GAGAGCATGAGGAAGGTGTGGGG + Intergenic
1070908803 10:80099533-80099555 GAGAAGAAAAGAAAGGAGGGAGG + Intergenic
1070935133 10:80288149-80288171 AAGAACAAGAGCAAGGAAGATGG + Intronic
1070969205 10:80549661-80549683 GGAAACAAGAGCAAGGTGGCAGG - Intronic
1071055447 10:81503788-81503810 GAGACCAGGAGCCAAGTGGGAGG + Intergenic
1071204152 10:83254784-83254806 GAAATCAAGAGCAAGGGAGGAGG + Intergenic
1071242803 10:83727165-83727187 AAGAGCAAGAGCAAGGTTGGGGG - Intergenic
1071358846 10:84824849-84824871 GAGAAGAAGAGAAAGAAGGGAGG - Intergenic
1072263658 10:93706433-93706455 GAGAAAGAGAGCAAAGAGGGAGG - Intergenic
1072452060 10:95546490-95546512 GAGCAAAAGAGCAAAGAGGGAGG + Intronic
1072872215 10:99132588-99132610 GAGAGCAAGACGAAGGAGGGTGG + Intronic
1073114340 10:101082842-101082864 GAGGACAAGAGAAAAATGGGAGG - Intergenic
1074159435 10:110824941-110824963 GAAAAAAAGAGCAAGTTGGATGG - Intronic
1074353857 10:112763995-112764017 GAGAAAAAGAGAGAGGTGGAAGG + Intronic
1074409170 10:113210932-113210954 GAGAAAAAGAGAAAGAAGGGAGG - Intergenic
1074409225 10:113211081-113211103 GAGAAAAAGAGAAAGAAGGGAGG - Intergenic
1074521826 10:114232663-114232685 GAAAACAAGAGAAAGCTGGTTGG - Intergenic
1074553947 10:114471130-114471152 GAGGCCAAGGCCAAGGTGGGTGG - Intronic
1074801905 10:117008226-117008248 GGGAACAGGACCAAGGTGTGGGG + Intronic
1074935189 10:118171400-118171422 GAGAACAAGACCTGGGTGCGAGG + Intergenic
1075741482 10:124698923-124698945 GAGGGCCAGAGCAAGGTTGGGGG - Intronic
1075927740 10:126266787-126266809 GAGGAAGAGAGAAAGGTGGGAGG + Intronic
1076051084 10:127333637-127333659 AAGAACAAAAGCAAGGCTGGCGG + Intronic
1076161218 10:128245617-128245639 GAGAAGGAGAGCTAGTTGGGGGG - Intergenic
1076539776 10:131206652-131206674 GAGAACAAGAGCATCGTGAGGGG + Intronic
1076602729 10:131669491-131669513 GAGAGGGAGAGCAAGGCGGGGGG + Intergenic
1077075921 11:702136-702158 GATAACAAGAGGAAGGGTGGGGG - Intronic
1077114813 11:879231-879253 AAGAAAAAGAATAAGGTGGGTGG - Intronic
1077447663 11:2606494-2606516 AAGAGCAGGAGCAAGGTGGAGGG - Intronic
1077485391 11:2836115-2836137 GAGACCAAGAGGCAGATGGGTGG + Intronic
1077836460 11:5931281-5931303 TAGGAGAAGAGCTAGGTGGGTGG - Intronic
1077915856 11:6611181-6611203 CGGAGCAAGAGCAAGGTGTGAGG - Exonic
1077993526 11:7433124-7433146 CAGAGCAGGAGCAAGGGGGGTGG - Intronic
1078099300 11:8320363-8320385 GAGAAAAAGAGAGAGGTGGAGGG + Intergenic
1078398995 11:11007725-11007747 GAGAACAAGAGGAAGCAGGAGGG - Intergenic
1078577935 11:12517321-12517343 GGGGACCAGAGCATGGTGGGGGG - Intronic
1078706551 11:13749199-13749221 GAGAACCAGGGCAAGCTGGAGGG + Intergenic
1078948493 11:16099994-16100016 GAGAACAAGGACAAGGCAGGAGG + Intronic
1078949817 11:16117578-16117600 GAAAGCAAGAGCAAGGTAAGGGG + Intronic
1079388054 11:19998289-19998311 GAGAAGGAGAGGGAGGTGGGCGG - Intronic
1079397956 11:20082297-20082319 GAGAAGCACAGGAAGGTGGGAGG + Intronic
1079925051 11:26483586-26483608 GGAAACATGATCAAGGTGGGAGG - Intronic
1080424414 11:32143096-32143118 GAGATCAAGAGGAAGCTGGATGG - Intergenic
1080573398 11:33577253-33577275 GAGAAGAAGAACAAGGTGTGGGG + Intronic
1081068227 11:38575887-38575909 AAGAGCAGGAGCAAGGTTGGGGG + Intergenic
1081198344 11:40187876-40187898 GAGGAAAAGAGAAAGGTGTGTGG + Intronic
1081981756 11:47270815-47270837 GAGAACTGGAGCAAGGAGGCTGG - Intronic
1082198941 11:49339568-49339590 GAGCAAAAGAGCAAAGGGGGAGG - Intergenic
1082849792 11:57754585-57754607 GAGAACAAGAGAAAGAAAGGAGG - Intronic
1083047426 11:59749366-59749388 GAGAACCACAGTCAGGTGGGAGG - Intronic
1083361000 11:62108096-62108118 GAAAGCAAGAGGCAGGTGGGTGG - Intergenic
1083367204 11:62148540-62148562 GAGAAGAAGAAGAAGGTGAGGGG + Exonic
1084135067 11:67172213-67172235 GAGAACAAAAGAAAGCTAGGAGG - Intronic
1084415477 11:69030180-69030202 GAGAAAAAAAGAAAGGAGGGAGG - Intergenic
1084847406 11:71911319-71911341 GATACCAGGAGCAAGGTGGCGGG - Intronic
1085300436 11:75455368-75455390 GAGGGCAGGAGGAAGGTGGGGGG + Intronic
1085600481 11:77851679-77851701 GAAAGCAGGAGCAAGGTTGGGGG - Intronic
1085998914 11:81955193-81955215 GATACCAGGAGCAAGGTGGCGGG - Intergenic
1086398360 11:86440560-86440582 GAAAACCAGAGAAATGTGGGTGG - Intergenic
1086656871 11:89368519-89368541 GAGCAAAAGAGCAAAGGGGGAGG + Intronic
1086845593 11:91746143-91746165 AAGAACAAGATCAAGGTGCCAGG - Intergenic
1087738676 11:101862788-101862810 TAGTACAAGAGCAAGGTAGCAGG + Intronic
1088197678 11:107293867-107293889 GAGGGCAAGAGGAAGGAGGGCGG + Intergenic
1088969188 11:114756902-114756924 GAAAACAAGAGGAACGTAGGCGG - Intergenic
1089576469 11:119447864-119447886 GAGGAGCAGAGAAAGGTGGGTGG - Intergenic
1089647693 11:119890905-119890927 GAGACCAAGAAGCAGGTGGGAGG + Intergenic
1090090916 11:123696957-123696979 AAGTCCAAGATCAAGGTGGGTGG - Intergenic
1090927443 11:131260990-131261012 AAGCACACGAGCAGGGTGGGAGG - Intergenic
1091398920 12:171198-171220 GAGAAGAAGAACAAGGGGGCAGG - Intronic
1091540133 12:1453044-1453066 AAGAACAAGAGCATGGAGAGAGG - Intronic
1091624598 12:2112477-2112499 GAGAACAGGAGGAAGGTGAAGGG + Intronic
1092191452 12:6524252-6524274 GAGAATCAGAGCAAGGAGGGAGG + Intronic
1092308493 12:7325978-7326000 GAGAATAAGAACATGGTGGCAGG - Intronic
1092517249 12:9227433-9227455 GGGAGCATGAGCAAGGTGTGGGG + Intergenic
1092649401 12:10616949-10616971 AAAGAGAAGAGCAAGGTGGGTGG - Intergenic
1092747795 12:11689821-11689843 GAGAAAAAGACAAAGGGGGGTGG - Intronic
1092864263 12:12746124-12746146 GAGAACAAAAGGAAGGGTGGTGG + Intronic
1093040994 12:14379228-14379250 AAGAACAAGAGAAAGGTGAGAGG - Intronic
1093516999 12:19999563-19999585 CAAAACAAGAGTAAGATGGGTGG + Intergenic
1093868405 12:24256650-24256672 GAGAAGAGGGGCAGGGTGGGTGG + Intergenic
1093889980 12:24508321-24508343 GAGAACAGGAATAAGGTAGGGGG + Intergenic
1094172327 12:27506562-27506584 GAGAACGAGAGCAAGTTGGTTGG - Intergenic
1095085939 12:38057398-38057420 AAGAAAAAGAAAAAGGTGGGGGG + Intergenic
1095195810 12:39315276-39315298 GAAAACAAGTGCAAAGAGGGAGG + Intronic
1095924572 12:47565391-47565413 GATAACAAGAGCAAGAAAGGTGG + Intergenic
1096013766 12:48247222-48247244 GAGAAACAGAGCAAGTGGGGAGG + Intergenic
1096037680 12:48486857-48486879 GAGCAACAGAACAAGGTGGGAGG - Intronic
1096058357 12:48674680-48674702 GTGCACAAGGCCAAGGTGGGTGG + Intronic
1096718728 12:53505965-53505987 GAGAGCAAGAGAGAGGAGGGAGG - Intronic
1097335424 12:58377463-58377485 GAAAAAGAGAGCAAAGTGGGAGG - Intergenic
1097513284 12:60570202-60570224 GGGGAAAAGAGCAATGTGGGAGG - Intergenic
1097860282 12:64512035-64512057 GGGAAGAAGAGAAAGGAGGGGGG + Intergenic
1097926981 12:65139527-65139549 GAGTATCAGAGCATGGTGGGAGG - Intergenic
1098399135 12:70054612-70054634 GAGAGCAAGGGCATGGTGGTGGG - Intergenic
1098639373 12:72821030-72821052 GATACCAGGAGCAAGGTGGCAGG + Intergenic
1098805457 12:75016151-75016173 GTGAATGAGAGCCAGGTGGGAGG - Intergenic
1099163004 12:79268689-79268711 GAGAAATAGAGCTATGTGGGAGG + Intronic
1099215689 12:79850819-79850841 GAGAAAGAGAGCAAAGAGGGAGG - Intronic
1099724652 12:86410931-86410953 GAGGAGGAGAGCAAAGTGGGAGG - Intronic
1099866661 12:88291247-88291269 GAGAATAGGAGCAAGTTAGGAGG + Intergenic
1100343006 12:93699577-93699599 GAAAACAAAGACAAGGTGGGGGG - Intronic
1100893745 12:99156273-99156295 GAGAACAAAATCAATGTAGGTGG - Intronic
1101421981 12:104557704-104557726 AGGAGCAAGAGCATGGTGGGAGG + Intronic
1101695537 12:107122306-107122328 GAGAAGAAGAGGAAGGAGGTTGG + Intergenic
1102194729 12:111016928-111016950 GAGAAGAAGAGAAGGGAGGGAGG - Intergenic
1102578988 12:113874012-113874034 GAGAACAGCAGCAAGGTGGAGGG + Intronic
1102591525 12:113959878-113959900 GAGAAGAAGAAAAAGGTGGCAGG - Exonic
1103230550 12:119326914-119326936 GGGAGCAGGACCAAGGTGGGGGG - Intergenic
1103808220 12:123591485-123591507 GATGAAAAGAGCAAGGTGGCTGG + Intronic
1104202714 12:126607343-126607365 GAGCAGAACAGAAAGGTGGGTGG - Intergenic
1104687328 12:130795794-130795816 GAGAACAAGCACAGGCTGGGCGG - Intronic
1104699627 12:130892146-130892168 GAGGCTAAGAGCAAAGTGGGAGG - Intergenic
1104714378 12:131006641-131006663 CAGAAGGAGAGCAAGGAGGGTGG + Intronic
1104738594 12:131155458-131155480 GAGAACAAGTGGAAGGTCTGAGG - Intergenic
1104768539 12:131345965-131345987 GAGAAGAAGGGCAAGGTGGCAGG + Intergenic
1105046409 12:133007541-133007563 GTGAGAAAGAGGAAGGTGGGAGG + Intronic
1105849596 13:24322382-24322404 TAGAAAATGAGCAAAGTGGGAGG - Exonic
1106755736 13:32821292-32821314 GAGGACTAGAGGAAGCTGGGTGG + Intergenic
1107139935 13:36987512-36987534 GAGAACAGGAGCAAGTTAGCGGG - Intronic
1107995275 13:45853019-45853041 CAGAACAAGAGCCATGAGGGAGG - Intergenic
1108612552 13:52097990-52098012 GAGAAAGAGAGCAAAGGGGGAGG - Intronic
1108803294 13:54126651-54126673 AATAACAAGATCAAGGTGGCTGG - Intergenic
1109149152 13:58823140-58823162 GAGCAGAAGAACAAGGTGGAAGG + Intergenic
1109277406 13:60317861-60317883 GGGAACAAGACCAAGGTGTGAGG + Intergenic
1109423835 13:62147093-62147115 AAGAACAGGAGCAAGGGGTGGGG + Intergenic
1109968495 13:69734206-69734228 GAGCAAAAGATCCAGGTGGGAGG - Intronic
1110488213 13:76070928-76070950 GAGAGAGGGAGCAAGGTGGGGGG + Intergenic
1110842741 13:80161431-80161453 GAGAGAAAGAGAATGGTGGGGGG + Intergenic
1111051052 13:82883632-82883654 AAGAAAAAGAGAAAGATGGGTGG + Intergenic
1111973942 13:94946086-94946108 AAAACCAAGAGCAATGTGGGTGG - Intergenic
1113030904 13:105992738-105992760 GAGAAAAAGAGAAAGGGGAGGGG - Intergenic
1113499423 13:110761415-110761437 CAGAACAGGAGCAAGATGGTGGG - Intergenic
1114490752 14:23100259-23100281 AAGAAGAAGAAAAAGGTGGGGGG + Exonic
1114633943 14:24177111-24177133 GAGAGGAAGAGCAAGGGGAGGGG - Intronic
1114894169 14:26965085-26965107 TAGCACAAGGGCAAGGTAGGTGG + Intergenic
1116016775 14:39417193-39417215 GAGAACAAAAGAAGGGTGAGTGG - Intronic
1116739499 14:48736147-48736169 GAGAAGGAGAGCAAGGTGGGAGG + Intergenic
1116790807 14:49337898-49337920 GAAAAGAAGAGCAAAGTTGGAGG - Intergenic
1116866851 14:50038297-50038319 GTGAACAAGAGTCAGGTGGGCGG - Intergenic
1118813350 14:69291500-69291522 CTGACCAAGAGCAGGGTGGGTGG - Intronic
1119722332 14:76899645-76899667 TAGAACAAGAGTGAGGAGGGCGG + Intergenic
1120708598 14:87770751-87770773 GAGAGCAAGAGCCAGGTGGGTGG - Intergenic
1121681065 14:95793024-95793046 GAGAGCAGGAGCAAGGGGCGCGG - Intergenic
1122480237 14:102042493-102042515 GAGATCAACCCCAAGGTGGGTGG + Exonic
1122746488 14:103900001-103900023 GTGAAGAAGAGCACGGTGGGTGG + Intergenic
1122821146 14:104345805-104345827 GACAAAAAGAGAAAGGAGGGAGG + Intergenic
1122874637 14:104658323-104658345 GAGAACAAGATGGAGGTGCGTGG - Intergenic
1124024741 15:25954863-25954885 GGGAACAAGAGCCTGGTGAGGGG + Intergenic
1124423380 15:29541454-29541476 GAAGACAAGAGCAAGCGGGGAGG + Intronic
1124699480 15:31900199-31900221 GAGAGCAAGAGAGAGGAGGGAGG - Intergenic
1125226880 15:37405507-37405529 AAGAACAAGAGAGAGATGGGGGG + Intergenic
1125251933 15:37714383-37714405 CGGAACAGGACCAAGGTGGGAGG - Intergenic
1127267530 15:57374110-57374132 AAGAAAAAGAGAAAGGAGGGAGG - Intergenic
1128534034 15:68476850-68476872 GAAACCAGGAGCAAGGAGGGAGG - Intergenic
1128930141 15:71697027-71697049 GAGAACAGGAGAAAGGAAGGAGG + Intronic
1128931065 15:71705294-71705316 GAGAGGAAGAGCAAGGCGGGCGG + Intronic
1129513819 15:76144383-76144405 GGGAACCAGAGCAAGGGAGGAGG - Intronic
1130260755 15:82352674-82352696 GACAACAAGAGAAAAGAGGGAGG - Intergenic
1130280482 15:82516333-82516355 GACAACAAGAGAAAAGAGGGAGG + Intergenic
1130471853 15:84232516-84232538 GACAACAAGAGAAAAGAGGGAGG + Intergenic
1130479347 15:84347087-84347109 GACAACAAGAGAAAAGAGGGAGG + Intergenic
1130492423 15:84441042-84441064 GACAACAAGAGAAAAGAGGGAGG - Intergenic
1130594151 15:85237153-85237175 GACAACAAGAGAAAAGAGGGAGG + Intergenic
1130601766 15:85280254-85280276 CAGAGCCAGAGGAAGGTGGGGGG - Intergenic
1130710848 15:86279591-86279613 GAGAATAAGGGAGAGGTGGGAGG - Intronic
1131364135 15:91823441-91823463 CAGAGCAGGAGCAAGGTGGGTGG - Intergenic
1131463971 15:92639751-92639773 AAGAGAAAGAGCAAGGCGGGAGG - Intronic
1131613005 15:93984720-93984742 GAGAACAGAAGCAAGGTGAAGGG - Intergenic
1132144058 15:99416419-99416441 GAGAAGGCGGGCAAGGTGGGGGG + Intergenic
1132746230 16:1437499-1437521 GTGAACAAGAGCACGAGGGGTGG + Intronic
1132842104 16:1983170-1983192 GAGACCAAGCCCAAGGTGGCAGG - Intronic
1133460684 16:5983983-5984005 GAGAAGAAGAAGAATGTGGGAGG - Intergenic
1134449326 16:14354029-14354051 GGGAATGAAAGCAAGGTGGGGGG + Intergenic
1135111653 16:19695041-19695063 GAGCCCAAGGCCAAGGTGGGCGG - Intronic
1135174297 16:20214567-20214589 GAGAAGAAGAGGAAGGGGTGGGG + Intergenic
1135290793 16:21236188-21236210 GAGCAAGAGAGCAAGGGGGGAGG + Intronic
1135484895 16:22855560-22855582 GAGTTCAAGAGCAGGGTGGCAGG - Intronic
1135918831 16:26629895-26629917 GATCAAAAGTGCAAGGTGGGAGG + Intergenic
1136023360 16:27454286-27454308 GAGGAAGAGAGCAAAGTGGGAGG + Intergenic
1136049431 16:27640003-27640025 GAAAAAAAGAGCAAGGCTGGGGG - Intronic
1136146116 16:28317618-28317640 GTGAACAAGTGCAGGGTGGCAGG + Intronic
1137548590 16:49421266-49421288 GAAAACTAAAGCAAGGTGGAGGG + Intergenic
1138055346 16:53827215-53827237 TAGAAGAAGAGAAATGTGGGTGG - Intronic
1138198891 16:55074417-55074439 GAGGACAAGGGCCAGGAGGGTGG + Intergenic
1138217153 16:55214470-55214492 GAGAAGAACAGGAAGGAGGGAGG + Intergenic
1138539098 16:57677710-57677732 GAGAACAAGGGCAGAGAGGGAGG - Intronic
1138773108 16:59688116-59688138 GAGGAAGAGAGCAAGGAGGGTGG + Intergenic
1139315513 16:66064719-66064741 CAGAACAACAGCACAGTGGGAGG + Intergenic
1139346594 16:66307740-66307762 GAGAACATGAGTGAGGTGAGAGG + Intergenic
1140250320 16:73289320-73289342 CAGAGCAAGGGCAGGGTGGGGGG + Intergenic
1140609612 16:76582216-76582238 TTGAAGAAGAGCAAGGTAGGAGG - Intronic
1142325601 16:89412442-89412464 GAGAAGAAGAGGAAGGTAGGAGG - Intronic
1142793062 17:2283617-2283639 GAGACCAAGCGGAAGGTGAGTGG - Exonic
1142857511 17:2739776-2739798 GAGAAGAAGAGGAAGAAGGGAGG - Intergenic
1143805662 17:9424211-9424233 GAGAATAACAGCAGGGTGGCCGG + Intronic
1144023927 17:11261098-11261120 AGGAACCAGAGCAAGGAGGGGGG + Intronic
1144121438 17:12157764-12157786 CAGAGCAAGAGCAAGGTGTAGGG - Intergenic
1144183348 17:12772931-12772953 GAGAGAAAGAGGAGGGTGGGTGG + Intergenic
1144457432 17:15430607-15430629 GAGAAGAAGGGAAAGGAGGGAGG + Intergenic
1144501252 17:15787739-15787761 GGGAACCAGAGCCAGGTGTGAGG - Intergenic
1145163421 17:20590413-20590435 GGGAACCAGAGCCAGGTGTGAGG - Intergenic
1145292283 17:21557651-21557673 GAGAACATGTGCAAGGTGAGTGG + Intronic
1145387756 17:22429352-22429374 GAGAACATATGCAAGGTGAGTGG - Intergenic
1146980918 17:37160817-37160839 AAGAACAGAAGAAAGGTGGGAGG + Intronic
1146981191 17:37163232-37163254 GGGAGCAAGAGAGAGGTGGGGGG - Intronic
1147581048 17:41627296-41627318 GTGGTGAAGAGCAAGGTGGGTGG - Intergenic
1147810137 17:43162957-43162979 GATACCAGGAGCAAGGTGGTGGG + Intergenic
1147917298 17:43896424-43896446 GAGAAAAAGACCAAGGTCAGAGG - Intronic
1147924284 17:43937194-43937216 AAGAAAAAGAGCAAGATGAGGGG + Intergenic
1149114165 17:53071729-53071751 GAGAAGAAGAAAAAGGAGGGAGG + Intergenic
1149380503 17:56088650-56088672 GAGAACAGGAGGAAGATAGGTGG - Intergenic
1149884944 17:60330523-60330545 GAGAAAGAGAGAAAGGAGGGAGG - Intronic
1150287026 17:63960418-63960440 GAGAACCAGGGCTGGGTGGGTGG - Intronic
1150353128 17:64461059-64461081 GAAAACATGAGAAAGGGGGGCGG + Intronic
1150597211 17:66616782-66616804 GAGAAAAAGAGCAGAGTGGCTGG + Intronic
1150833551 17:68543890-68543912 GAGAAGACAAGCAAAGTGGGAGG + Intronic
1150931584 17:69590557-69590579 AAGAACAAGAGGCAGGAGGGTGG - Intergenic
1150999095 17:70352592-70352614 GAGGAGGAGAGTAAGGTGGGTGG - Intergenic
1151029308 17:70717724-70717746 GAAAACAAGAGGGAGGTCGGGGG + Intergenic
1151122317 17:71807165-71807187 GAGAGCAGGAGCAAGCAGGGAGG + Intergenic
1151355189 17:73553966-73553988 GAGGACAGGAGCATGGAGGGAGG + Intronic
1151938755 17:77280330-77280352 GAGGACGAGAGGAAGGCGGGAGG - Intergenic
1152000180 17:77640437-77640459 GAGGCCAGGAGCTAGGTGGGAGG + Intergenic
1152466904 17:80471651-80471673 GGGAAGAGGAGCAAGGAGGGAGG - Intronic
1152495496 17:80668454-80668476 GAGAACAAGTGCATGCTGAGGGG - Intronic
1153295025 18:3536828-3536850 GAGAACATGGGGAAGGTGGGAGG + Intronic
1153553287 18:6284761-6284783 GTGCAACAGAGCAAGGTGGGAGG + Intronic
1154013973 18:10600139-10600161 GATACCAGGAGCAAGGTGGTGGG + Intergenic
1154326866 18:13397618-13397640 GATAACAAGAGACAGGTGGTAGG - Intronic
1155234386 18:23804842-23804864 AAGAACAGAAGCAAGGTAGGGGG - Intronic
1155285675 18:24286779-24286801 GAGAACTCTAGCAAGGTGAGAGG + Intronic
1155610641 18:27663585-27663607 GAGAACAAGAGCCAGGTGAAAGG + Intergenic
1156154576 18:34286983-34287005 GAGAGCAGGAGCAAGGTGTAGGG + Intergenic
1156270800 18:35528864-35528886 GAGAGCGAGAACAAAGTGGGAGG + Intergenic
1156282690 18:35656604-35656626 GAGAACAAGAGCACAGGAGGTGG + Intronic
1156661235 18:39349097-39349119 GAGAACCAGATCAAGGAGTGGGG + Intergenic
1156741498 18:40335724-40335746 AAGAGCAAGAGAAAAGTGGGAGG - Intergenic
1157115084 18:44854894-44854916 GAGAAAAAGAGCAAGGGCAGTGG - Intronic
1157129794 18:44996137-44996159 GAGAAGAAGAGAAAAGAGGGAGG - Intronic
1157329364 18:46692276-46692298 GAGTACATGAGCAGGGTAGGCGG + Intronic
1157879164 18:51303843-51303865 GAGAAGCAGAGCAAGATGGCTGG + Intergenic
1158422874 18:57311837-57311859 GAGAGTAACAGCAAGCTGGGAGG + Intergenic
1159000445 18:62969984-62970006 GAAAACAATAGTAAGGTGGAAGG - Intronic
1159667456 18:71179488-71179510 TAGAAAAATAGCAAGGTGGCCGG + Intergenic
1159702783 18:71650296-71650318 GGGAGCAGGAGCAAGGTGTGGGG - Intergenic
1159890967 18:73952876-73952898 GAGATCAAGACACAGGTGGGAGG + Intergenic
1160312547 18:77809416-77809438 GAGAACATGGGCATGCTGGGAGG - Intergenic
1160337973 18:78059800-78059822 GAGGAGAAAAGCAAGGTGTGGGG - Intergenic
1160501877 18:79405602-79405624 TAGAAGAAGGGCAAGGTGTGGGG - Intronic
1161253246 19:3292706-3292728 GAGAACGAGAGAAAGAGGGGAGG + Intronic
1162038055 19:7953172-7953194 GAGAGCCAGCGCATGGTGGGAGG - Intergenic
1162282066 19:9706788-9706810 GATACCAAGAGCAAGGTGGCAGG - Intergenic
1162558479 19:11402207-11402229 GAGAAGAGGAGGAAGGTGAGTGG - Exonic
1162957175 19:14105899-14105921 GAGAACAAGAGCACTCTTGGGGG - Intronic
1163267151 19:16228194-16228216 GAGTACATGATCAAGGTGCGTGG + Exonic
1163538628 19:17893436-17893458 GAGAAGCAGAGAAAGGAGGGAGG + Intronic
1164265380 19:23610925-23610947 GAGAACAAGAAAAAGCAGGGTGG - Intronic
1164475553 19:28573214-28573236 GAGAACAAGAGCCAGGTTTGAGG - Intergenic
1164620368 19:29691994-29692016 GAGGTCAAGAGCAGGTTGGGAGG - Intergenic
1165427614 19:35754680-35754702 GAGAAGAGGAGGAGGGTGGGAGG + Exonic
1165443621 19:35844713-35844735 GAGGACAAATGCAAGATGGGAGG + Intronic
1165613626 19:37179131-37179153 GGGAACAAGAGGAATGTGGCAGG - Intronic
1165723839 19:38099004-38099026 GAGAAGAAAAGAAAGGAGGGAGG - Intronic
1165793588 19:38506276-38506298 GAGGACAAGGGGAAGATGGGAGG - Intronic
1165960307 19:39528689-39528711 GAAAAGAAGAGCAATGAGGGTGG + Intergenic
1167715392 19:51139707-51139729 GAGAGCAGAAGCAAGGTGAGGGG + Intergenic
1167942558 19:52959327-52959349 GATACCAAGAGTAAGGTGGCGGG - Intronic
925698200 2:6605482-6605504 GAGAATAAGATCAAACTGGGTGG + Intergenic
926630524 2:15131866-15131888 GAGAGCAGGAGCAAGGGAGGGGG + Intergenic
928068387 2:28189836-28189858 GAAAAGAAGAGCAAAGTTGGAGG + Intronic
928180724 2:29066586-29066608 CTGAACAAGATCGAGGTGGGTGG + Intronic
928365676 2:30699182-30699204 GAAAACAAAAGCAAAGTTGGAGG - Intergenic
928746728 2:34424752-34424774 GAGAAGGAGAGAAAGGAGGGGGG + Intergenic
930403983 2:50930383-50930405 GAGAAAAAGAGAAAGGGGGCAGG + Intronic
930499408 2:52193154-52193176 GAGAACATGTGCAAGGTGGTTGG - Intergenic
931221306 2:60290617-60290639 GGGAACTAAAGGAAGGTGGGTGG + Intergenic
932160843 2:69458168-69458190 GTGAACAAGAGAAAGGAGGGGGG - Intronic
932204530 2:69867317-69867339 GAGCACAAGAGCATGGGGGAAGG - Intronic
932349891 2:71023241-71023263 GATACCAGGAGCAAGGTGGCAGG - Intergenic
932562749 2:72887421-72887443 GAGAACAGGAGCATGGAGGGCGG + Exonic
932645906 2:73501727-73501749 GAAAACAAAAACAAGGTTGGAGG - Intronic
933542914 2:83671265-83671287 GGGAACAAAAGAAAGGAGGGAGG + Intergenic
933853006 2:86385878-86385900 GAGGACAAGAGAAAAGTGGAGGG - Intergenic
934903553 2:98179935-98179957 GAGAAAGAGAGAAAGGAGGGAGG - Intronic
935144882 2:100388855-100388877 GAGGTGCAGAGCAAGGTGGGAGG + Intergenic
935231745 2:101104413-101104435 GAGAAGAAGAACAAAGTTGGAGG + Intronic
935300988 2:101693827-101693849 GAGAAATAGAGCAAGATGGCTGG - Intergenic
935661583 2:105471252-105471274 GAGAACCAGAGAAAGCTTGGGGG - Intergenic
935721319 2:105981847-105981869 GATACCAGGAGCAAGGTGGCAGG + Intergenic
935931544 2:108132450-108132472 GAGAGCAGGAGCAAGGGGAGAGG + Intergenic
936600193 2:113888513-113888535 GAGAATGAGAGGAAGGTGGAAGG - Intergenic
936661226 2:114546304-114546326 GAAAGCAAGAGCAAGTGGGGAGG + Intronic
937515506 2:122650645-122650667 GAGAGTGAGGGCAAGGTGGGTGG + Intergenic
937691920 2:124766189-124766211 AATAACAAGGGCAAGGTGGTGGG - Intronic
937823269 2:126335440-126335462 GAGAGAAAGACCAAGATGGGTGG - Intergenic
937842103 2:126534432-126534454 AGGAACAAGAGAAAGGAGGGTGG + Intergenic
938952395 2:136267031-136267053 GTGAGCAGGAGCAGGGTGGGGGG - Intergenic
939481472 2:142753363-142753385 GAGAAAGAGAGGAAAGTGGGAGG - Intergenic
940872145 2:158869016-158869038 GATACCAGGAGCAAGGTGGCGGG - Intergenic
941091462 2:161181602-161181624 GAGAGAGAGAGCAAGGAGGGGGG + Intronic
941947795 2:171119354-171119376 GAGAACAAGAAGGTGGTGGGGGG - Intronic
942006628 2:171708333-171708355 GAAAAAAAAAGCAAGGTGGCTGG + Intronic
942669441 2:178358282-178358304 GATAACCAGAGCAACCTGGGGGG + Intronic
943052535 2:182933634-182933656 GATCACCTGAGCAAGGTGGGTGG - Intronic
943532383 2:189099379-189099401 GAGAATGAGGCCAAGGTGGGTGG + Intronic
944349135 2:198706071-198706093 AAGAAAAAAAGAAAGGTGGGAGG + Intergenic
944662002 2:201929023-201929045 AGGAACAAGAGCAAGTGGGGTGG - Intergenic
944863305 2:203835993-203836015 GAGAACCAGAGCAAGTGGGCAGG + Intergenic
945020026 2:205561171-205561193 GAGAACAAGAGAAATCTGAGAGG - Intronic
945277806 2:208005919-208005941 GAGTAAAACAACAAGGTGGGTGG - Intronic
945289919 2:208116757-208116779 GATACCAGGAGCAAGGTGGTGGG - Intergenic
945929022 2:215836317-215836339 GTAAACAAAACCAAGGTGGGTGG - Intergenic
946100205 2:217314119-217314141 CAGAACAAGAGGAAGGGGGCTGG - Intronic
946801652 2:223423738-223423760 TAGCAAGAGAGCAAGGTGGGGGG - Intergenic
947197921 2:227587157-227587179 GAGAACCAGGGCGAGGTTGGGGG + Intergenic
948033136 2:234836088-234836110 GAGAACAAGAGGAAAGAGGGTGG - Intergenic
948791952 2:240383730-240383752 AAGAACAAAAGGAAGATGGGTGG - Intergenic
1170532688 20:17310081-17310103 AAGAGAAAGAGCAAGGGGGGAGG + Intronic
1172801006 20:37576198-37576220 GAGACCAAGAGCAAGGAGGAAGG - Intergenic
1173051871 20:39571282-39571304 GAGATAATGAGAAAGGTGGGGGG + Intergenic
1173201200 20:40956486-40956508 GAGAAAAAGTTCATGGTGGGGGG + Intergenic
1173280298 20:41620927-41620949 GAGAGCAAGAGGAAGATGGAAGG + Intergenic
1173504480 20:43576142-43576164 GAGACTTGGAGCAAGGTGGGCGG - Intronic
1173845691 20:46186957-46186979 GAGCACAGGAGCAAGGGGAGAGG + Intronic
1174116470 20:48229843-48229865 GAGAACCAGAACAAGGTGGGTGG - Intergenic
1174123262 20:48283357-48283379 GAGAGAAGGAGCAAGGTGCGGGG + Intergenic
1174467974 20:50731838-50731860 GAGGTGAAGAGCAAGGTGCGCGG + Exonic
1174951366 20:55044816-55044838 GAGCAAGAGAGCGAGGTGGGAGG - Intergenic
1175101258 20:56580321-56580343 GTCAAAAAGAACAAGGTGGGTGG + Intergenic
1175292288 20:57884004-57884026 AAGAGACAGAGCAAGGTGGGAGG - Intergenic
1175414352 20:58792077-58792099 GGGAACAAAAGGAAGGTAGGAGG - Intergenic
1175513722 20:59554332-59554354 GATACCAGGAGCAAGGTGGTGGG + Intergenic
1175741849 20:61425261-61425283 GGGAACAGGAGCAGGGAGGGAGG + Intronic
1175792614 20:61751157-61751179 TAGAACAAGAAAAAGATGGGAGG + Intronic
1177170056 21:17644978-17645000 GAGAGCAAGAGCAATGTGTGTGG - Intergenic
1177475210 21:21611537-21611559 GAGAGCAAGAGTAAGGGGGTGGG - Intergenic
1178153067 21:29818558-29818580 GAGGATATGAGCAAGCTGGGAGG - Intronic
1178828876 21:36038479-36038501 GAGAATAAAAGCACGGGGGGTGG + Intronic
1178904386 21:36624453-36624475 GAGAAAAAGAGCAAGAGGGCTGG + Intergenic
1178988873 21:37334826-37334848 GAGAAAGAGAGCAAAGCGGGAGG + Intergenic
1179266537 21:39808355-39808377 GAGAGCAAGAGAGAGGGGGGAGG - Intergenic
1179669228 21:42934011-42934033 GATACCAGGAGCAAGGTGGCGGG - Intergenic
1180710238 22:17834644-17834666 CAGAACACAAGCACGGTGGGCGG + Intronic
1180864700 22:19110431-19110453 GACAAGAAAAGCAGGGTGGGTGG + Intronic
1180905836 22:19410655-19410677 CAGGAGAAGAGCAAGGTGGCAGG + Intronic
1181402734 22:22661144-22661166 GAGAACAGGAGCACAGTGTGGGG - Intergenic
1183383533 22:37502531-37502553 GGGAACAGGAGTGAGGTGGGAGG - Intronic
1183516487 22:38269838-38269860 GACAACAAGAGAAAGGCGGCGGG + Intronic
1183707161 22:39481151-39481173 GTGAAGAACAGCAAGGCGGGTGG - Intronic
1183715496 22:39530943-39530965 GAGAACAAGATTACGGGGGGAGG + Intronic
1183846305 22:40543887-40543909 TTGAACAAGAACAAGGTGGGAGG + Intronic
1184051540 22:42009157-42009179 CAGCACAAGGCCAAGGTGGGTGG - Intronic
949494784 3:4621320-4621342 GAGCAAGAGATCAAGGTGGGAGG + Intronic
950020788 3:9786233-9786255 CAGAATAAGAGCAAGGAGGCCGG - Intronic
950247717 3:11437132-11437154 GAGAACCAGAGAAAGGAGAGAGG - Intronic
952255336 3:31690256-31690278 GAGAAAGAGAGCAAAGGGGGAGG - Intronic
952728990 3:36619529-36619551 GAGCACAAAGGCAGGGTGGGGGG - Intergenic
952877875 3:37962369-37962391 GGGAACAAGGCCAAGTTGGGAGG - Intronic
952962051 3:38598456-38598478 GGGAACAAGATCAGGATGGGGGG + Intronic
953156200 3:40376981-40377003 GAGAAGAAGAGAAAGGCAGGCGG + Intergenic
953690458 3:45113393-45113415 GAAAACAAGAGGAAAGTGAGGGG + Intronic
953708313 3:45247800-45247822 GAGAGCAAGAGAAAGGTGGGAGG - Intergenic
954081658 3:48215759-48215781 GAGAAGGACAGCAAGGTTGGTGG + Intergenic
955551668 3:60091747-60091769 GAGAAGAAAGGCAAGGTGGGAGG - Intronic
955778742 3:62461751-62461773 GAGAGCAAGAGAAAGCGGGGAGG - Intronic
956604877 3:71064547-71064569 GAGCCAAAGAGCAAGGGGGGTGG + Intronic
957478802 3:80763468-80763490 GAAAACAAGAGCAAAGGGGATGG + Intergenic
957783589 3:84850389-84850411 GAGAGAAAGAGCAAGGGGGGAGG + Intergenic
959922380 3:111882875-111882897 GACAACAAGAGCTAGAGGGGTGG + Intronic
960220338 3:115100347-115100369 GAGAGCAAGAGAGAGGAGGGAGG + Intronic
960630941 3:119729742-119729764 GAGAACAAGTTGAAGGTAGGAGG + Intronic
961416275 3:126759985-126760007 GAGAACAGGAGCAAGGACTGGGG + Intronic
961752667 3:129106437-129106459 GAGGACCACAGCATGGTGGGAGG - Intronic
962436430 3:135371429-135371451 GGGAACAGGAGGGAGGTGGGTGG - Intergenic
962507883 3:136066661-136066683 GAGAGCAGGAGCAAGGTGTGGGG + Intronic
962627444 3:137239883-137239905 GAGAAAGAGAGGAAGGTGGGTGG + Intergenic
962871046 3:139493480-139493502 GAGGAAGAGAGCAAAGTGGGAGG - Intergenic
962982254 3:140501147-140501169 GAGAACAAGAGCAAGGTGGGTGG - Intronic
963039663 3:141059479-141059501 GAAAACAAGAGCAAGAGGCGGGG + Intronic
963771618 3:149392052-149392074 GAGAAAAAGAGGTAGGTGGAGGG - Intergenic
964267804 3:154920393-154920415 GAGGAAGAGAGCAAGGGGGGAGG + Intergenic
964567695 3:158075692-158075714 GAGCAAGAGAGCAAGGGGGGAGG - Intergenic
964831846 3:160892313-160892335 GAGAGCAGGAGCAAGGCTGGGGG + Intronic
966319462 3:178685020-178685042 GAGTAGAAGAGGAAGGAGGGAGG - Intronic
969008071 4:4037721-4037743 GAGCAAGAGAGTAAGGTGGGAGG - Intergenic
969019690 4:4131559-4131581 GATACCAGGAGCAAGGTGGCGGG + Intergenic
969506454 4:7591184-7591206 GAGAAGAAGGAGAAGGTGGGAGG - Intronic
969570605 4:8006102-8006124 GAGAACACGAGCCTGGTGGGTGG - Intronic
969745541 4:9068329-9068351 GAGCAAGAGAGTAAGGTGGGAGG + Intergenic
970097184 4:12477355-12477377 AAGAATGGGAGCAAGGTGGGTGG + Intergenic
970122756 4:12775276-12775298 GGAAATAAGGGCAAGGTGGGTGG - Intergenic
970162624 4:13204658-13204680 GAGAAGGAGAGCAAGGAGGATGG - Intergenic
970164024 4:13217217-13217239 GAGAGCAAGTGCAGAGTGGGTGG + Intergenic
971596432 4:28535001-28535023 GAGCAAGAGAGCAAGGGGGGAGG - Intergenic
973588352 4:52414441-52414463 GAGAACAAGAGTGAGGAGTGAGG + Intergenic
974136172 4:57821206-57821228 GACAACAACAGCAAGGGGGATGG + Intergenic
974224455 4:59020343-59020365 AAGCAAAAGAGCAATGTGGGAGG - Intergenic
974693491 4:65333455-65333477 GATTTCAAGAGTAAGGTGGGAGG - Intronic
975192165 4:71477734-71477756 GAAAACAAGTGAAAGTTGGGGGG - Intronic
975545954 4:75560804-75560826 GAGCACAAGAGGCGGGTGGGTGG + Intronic
975773865 4:77761336-77761358 GAAAAAAAGAAAAAGGTGGGAGG + Intronic
976382672 4:84418121-84418143 GAGAACAACAGGCAGGTGGCAGG + Intergenic
976592012 4:86858782-86858804 GAGAATCAGAGCAGGGTGGGGGG + Intergenic
977725915 4:100296722-100296744 AAAAACAAGAGCAAGGGAGGTGG - Intergenic
979019795 4:115481770-115481792 GAGCAAAAGAGCAAGGGGGAAGG - Intergenic
979580761 4:122356741-122356763 AAGAAAAAGAAAAAGGTGGGTGG + Exonic
979672332 4:123373119-123373141 AAGAAAAAGAGAAAGGAGGGAGG + Intergenic
979770820 4:124523014-124523036 GAGAACATGTCCAAGGTGGTTGG - Intergenic
979816190 4:125107884-125107906 GAGAAAAAGAGCAAAGTTAGAGG + Intergenic
980066160 4:128191233-128191255 GAGAAGAAAAGCAATGTGTGAGG - Intronic
980073169 4:128264897-128264919 GATACCAGGAGCAAGGTGGCGGG - Intergenic
980289299 4:130824968-130824990 GAGGAGGAGAGCCAGGTGGGAGG - Intergenic
980797199 4:137700025-137700047 GAGAAAGAGAGCAAGGAGGAAGG - Intergenic
981637681 4:146899209-146899231 GGGAACAATAGCAAGATGAGTGG - Intronic
982925192 4:161328286-161328308 GAGAGAAAGAGCAAAGTGGGAGG - Intergenic
983307930 4:166017671-166017693 AAGAACAAGAGGAAGGGAGGGGG - Intronic
983494846 4:168430875-168430897 GAGGAGAAGAGGAAGGTTGGGGG + Intronic
983696822 4:170542490-170542512 GACAACAAAAGCAAGATGGGAGG - Intergenic
983898142 4:173103479-173103501 GATACCAGGAGCAAGGTGGTAGG - Intergenic
985039257 4:185872694-185872716 GAGAAAAAGAGAAATGTGGTTGG + Intronic
985060508 4:186073010-186073032 TAGAAGAAGAGCAAGATGGGAGG + Intronic
985403071 4:189611379-189611401 GAGAGCCAGAGCATGGGGGGAGG - Intergenic
985888812 5:2700114-2700136 GGGAACCAGAGCCAGGTGAGGGG + Intergenic
988055734 5:26093199-26093221 GAAAGAAAGAGCAATGTGGGGGG + Intergenic
989095871 5:37780835-37780857 GATACCAGGAGCAAGGTGGCGGG + Intergenic
990327111 5:54689325-54689347 GAGATTAAAAGAAAGGTGGGGGG - Intergenic
990537991 5:56742728-56742750 GAGAAGAAGAAGAAGGGGGGAGG - Intergenic
990643933 5:57822325-57822347 GAGAACAAGAGCAAGACAAGAGG - Intergenic
990931299 5:61095151-61095173 GAGAACATGGGCAGGGTGGCTGG + Intronic
991127684 5:63086128-63086150 TAGCAAAAGAGCATGGTGGGAGG + Intergenic
991638172 5:68727151-68727173 GAGAACAAGAGGAAGGCAAGGGG + Intergenic
992259348 5:74954189-74954211 GATAAGAAGAGCATGGGGGGAGG + Intergenic
992530027 5:77644841-77644863 GAGAAAAAGAGAAAGGAGGAAGG - Intergenic
993123881 5:83808293-83808315 GAGAAGCAGACCAAAGTGGGAGG - Intergenic
993551123 5:89275215-89275237 GAGAACAAGAGAAAAGGGGGAGG - Intergenic
993830398 5:92750005-92750027 GAGGACAAAAGAATGGTGGGGGG - Intergenic
993971027 5:94420056-94420078 CATGACAAGATCAAGGTGGGGGG + Intronic
994546867 5:101177645-101177667 CAGAGCAGGAGGAAGGTGGGTGG - Intergenic
994896790 5:105716124-105716146 GAAAACAAGAGTGAAGTGGGAGG + Intergenic
995418781 5:111939089-111939111 AAGACCAAGAGCAAGGGGGACGG - Intronic
995734434 5:115284635-115284657 TATAACAAGAGAAAGATGGGAGG - Intronic
995760430 5:115556192-115556214 GAAAACAAGACCAAGGTGGTGGG - Intergenic
996218246 5:120894541-120894563 GAGAAGAAGAGAAAAGTGAGAGG + Intergenic
996622609 5:125526783-125526805 GATTAAAAGAGCAATGTGGGAGG + Intergenic
996715456 5:126584318-126584340 GAGAAAAACAGCAAGATTGGAGG + Intronic
996909918 5:128644338-128644360 GAGAAAAAAAGCAATGAGGGTGG - Intronic
997232823 5:132256745-132256767 GAGAACCAGAGGGAGGTTGGTGG + Intronic
997246742 5:132356190-132356212 AAAGACAGGAGCAAGGTGGGGGG - Intergenic
997707368 5:135969535-135969557 TAAAAGAAGAGCAAAGTGGGAGG - Intergenic
998064930 5:139150461-139150483 GAGAACAGGAGCATAGGGGGAGG - Intronic
999178364 5:149648379-149648401 GAGGAGGAGAGCAAGGAGGGAGG - Intergenic
999273274 5:150310967-150310989 GAGAAAAAAAGCAAAGTGAGAGG + Intronic
999383415 5:151137689-151137711 GGGAGCAGGAGCAAGGCGGGAGG - Intronic
999541991 5:152584362-152584384 GATAAGCAGAGGAAGGTGGGGGG + Intergenic
1000371285 5:160539238-160539260 CAGAACAAGAGCCATGTTGGGGG - Intergenic
1000902219 5:166925164-166925186 GAGAACGAGAGAGAGATGGGGGG + Intergenic
1001790893 5:174457278-174457300 GAGAACATGAGCCAGATGGAGGG - Intergenic
1002288017 5:178178240-178178262 GAGAAAGTGAGCAAGGTCGGGGG + Intergenic
1002705456 5:181158386-181158408 GAGGCCAAGGCCAAGGTGGGAGG + Intergenic
1002923004 6:1586482-1586504 GAAAACAAGAGGAAGGAGGAAGG - Intergenic
1003003858 6:2362332-2362354 GAGAGAAAGAGAGAGGTGGGTGG - Intergenic
1003117029 6:3289731-3289753 GAGGACAAGTGCCAGCTGGGTGG - Intronic
1003369518 6:5510756-5510778 GAGGACAAGAGGGGGGTGGGTGG - Intronic
1003412784 6:5880300-5880322 GGGAACAAGATCAAGGTCTGTGG + Intergenic
1003493426 6:6642988-6643010 GAGGCCAAGAGCAAAGTGGGAGG - Intronic
1003934174 6:10958359-10958381 GAGAGCAGGAGCAAGGGGCGGGG + Intronic
1004018513 6:11754693-11754715 GAGACCAGGAACAAGGTGTGGGG + Intronic
1004094494 6:12539133-12539155 GAGCACAAGGGGAAGGTGGTTGG + Intergenic
1004260629 6:14104517-14104539 GGGCTCAGGAGCAAGGTGGGAGG - Intergenic
1005024406 6:21448803-21448825 GAGAAAAAAAGCAAGGAGGGAGG - Intergenic
1005462106 6:26078967-26078989 GATACCAGGAGCAAGGTGGCAGG - Intergenic
1006494553 6:34412743-34412765 GTGAACAATACGAAGGTGGGAGG - Intronic
1007173552 6:39881277-39881299 GAGAAGTAGAGCAAGGTGAACGG + Intronic
1007573137 6:42907605-42907627 GGGAGCTAGACCAAGGTGGGGGG + Intergenic
1007574526 6:42916342-42916364 GAGCCCCAGAGCAAGGTGGCTGG - Intronic
1007822624 6:44571846-44571868 GGGAATAAGACAAAGGTGGGTGG + Intergenic
1008280379 6:49589029-49589051 GAGATCAAGAGCAAGAGGAGGGG - Intergenic
1008302984 6:49865561-49865583 GAAAACAAAAGGAAGGTGGTTGG + Intronic
1008871644 6:56279173-56279195 AAGAACAAGAGTGAGGTGGGAGG - Intronic
1011675742 6:89731805-89731827 GAGAAAAAGGAAAAGGTGGGGGG - Intronic
1012017822 6:93874350-93874372 GAAAACAAGAGCAAGTTGGGGGG - Intergenic
1012780413 6:103549860-103549882 GAAAAGAAGAACAAGGTTGGAGG + Intergenic
1012825254 6:104139431-104139453 GACAACATGTGCAAGGTGGTTGG - Intergenic
1013363976 6:109421153-109421175 GAGGACAAGAGTAATGTTGGTGG - Intronic
1013378683 6:109544536-109544558 GAGAAAGAGAGTGAGGTGGGAGG - Intronic
1014102362 6:117525828-117525850 GCGAATAAGAGCAGGGTGGATGG - Intronic
1014419001 6:121217825-121217847 GAAAACAAGATCAAGGTGTTAGG + Intronic
1015172092 6:130265179-130265201 GATACCAGGAGCAAGGTGGCGGG - Intronic
1015367572 6:132414276-132414298 AAGAACAGGTGCAATGTGGGAGG - Intergenic
1015621789 6:135139654-135139676 GAGAAGAAGAGAAAGGTGCTAGG + Intergenic
1015672561 6:135706781-135706803 GAAAGCAGGAGCAAGGTGGTGGG - Intergenic
1017143094 6:151209628-151209650 GAGAACAAGAGCAGGATGCAGGG - Intergenic
1017320987 6:153092889-153092911 GAAAACCAGTGAAAGGTGGGGGG + Intronic
1018158277 6:161011052-161011074 GAGAACAACAGAAAGAAGGGTGG + Intronic
1018364743 6:163108239-163108261 GAGGAAGAGAGCAAAGTGGGTGG - Intronic
1018377518 6:163227266-163227288 AGGAACAAGAGGGAGGTGGGAGG + Intronic
1019021765 6:168924561-168924583 GAGAGCAGGAGCAGAGTGGGAGG - Intergenic
1019651278 7:2160290-2160312 GAGAACAAGAACATGGCAGGAGG + Intronic
1020029795 7:4924827-4924849 GAGAGCAAGAGCATGGTGGTGGG + Intronic
1020154184 7:5708956-5708978 GAGAACAAGAGAAAGCTGGGTGG - Intronic
1020577783 7:9956356-9956378 AAAAAGAAGAGGAAGGTGGGGGG - Intergenic
1020731878 7:11891300-11891322 GAGTAAGAGAGCAAGGGGGGAGG - Intergenic
1020784620 7:12557650-12557672 GAGAAAAAGAGAAAGGGGGGAGG + Intergenic
1021934831 7:25620102-25620124 GAGAGCAAGAGAAGGGAGGGAGG - Intergenic
1024059814 7:45689481-45689503 GAGAGCAGGAGCAAGGGGGTGGG + Intronic
1024105093 7:46075375-46075397 GAGAAGAAGAGCAAGATAGCAGG - Intergenic
1024798331 7:53045975-53045997 GAAAAAGAGAGCAAGGTGAGGGG - Intergenic
1024800095 7:53067224-53067246 TAGAACAAGAGCAAGATGCAGGG + Intergenic
1024842198 7:53600178-53600200 GAGAGCAAGAGAGAGATGGGGGG + Intergenic
1025147243 7:56515419-56515441 GAAAACAAGAGCAAAGCTGGTGG + Intergenic
1026050751 7:66944511-66944533 GAGAAAGAGAGCAAGGTGTATGG + Intronic
1026474715 7:70725118-70725140 GAGAAAGAGAGCAAGGAGGTTGG + Intronic
1026638776 7:72106565-72106587 GAGAAAAAGAGGAAGGTGGAAGG + Intronic
1026939661 7:74280071-74280093 GAGAAAGAGAGAAAGGGGGGGGG - Intergenic
1027696032 7:81411731-81411753 GAGAGCAAGAGCTAAGCGGGCGG + Intergenic
1028605968 7:92656129-92656151 GAGAACAGGAGCGTGGAGGGAGG + Intronic
1028746129 7:94328662-94328684 AAAATCAGGAGCAAGGTGGGGGG + Intergenic
1029184482 7:98728781-98728803 GAGAAGGAGAGGAAGGAGGGAGG - Intergenic
1029254313 7:99259004-99259026 GAGAAAGAGAGCAAGGGGGGAGG + Intergenic
1029401990 7:100352538-100352560 TGGAACAGCAGCAAGGTGGGTGG - Intronic
1029504439 7:100954006-100954028 GAGACCAAGGGAGAGGTGGGTGG - Exonic
1030516764 7:110548666-110548688 GAGAAAAAGAGAAAGCAGGGAGG - Intergenic
1031647810 7:124248327-124248349 TAGAACAAGAGAAAAGTGGAGGG + Intergenic
1032020847 7:128406345-128406367 GGGGAGAAGGGCAAGGTGGGTGG - Intronic
1032799626 7:135307627-135307649 AAGAACAAGAGCAAGGCAAGAGG + Intergenic
1034437061 7:151067751-151067773 GAGAGCACGAGCACAGTGGGTGG - Intronic
1035067734 7:156120624-156120646 GAGGAAAAGATCAAGGTGGGAGG + Intergenic
1035913726 8:3596714-3596736 CAAAACAAGAGCCAGGAGGGTGG + Intronic
1036146235 8:6257527-6257549 GAGAAAAAGAGCAAAGGAGGAGG + Intergenic
1036640517 8:10580610-10580632 GGGAGCAAGAGCAAGGGAGGGGG - Intergenic
1036817719 8:11914327-11914349 AAGAACAATAGCAAAGTGGAGGG - Intergenic
1037115946 8:15227099-15227121 TAGCCCAAGAGAAAGGTGGGAGG + Intronic
1037334641 8:17780218-17780240 GAGAGCAAGAGCAAGGGGACGGG - Intronic
1037662879 8:20942182-20942204 GAGAAAAGGAGCAAGGGGGAGGG + Intergenic
1037691738 8:21186526-21186548 GAGAAGAGGAGCATGGAGGGAGG - Intergenic
1037776500 8:21839033-21839055 GAAACCCAGAGCAAGGAGGGAGG + Intergenic
1037926645 8:22848638-22848660 GAGAAAAAGAGGCAGGTGGGAGG + Intronic
1038452457 8:27648814-27648836 GAGAAAGAGAGAAAGGAGGGAGG + Intronic
1038713786 8:29973503-29973525 GTGAACAAGAGATAGGTGTGGGG + Intergenic
1039104382 8:33974406-33974428 GAGTACTAGAGCAGGGAGGGAGG + Intergenic
1039254994 8:35709314-35709336 GAGAAGCAGAGCAGGGTGGGGGG + Intronic
1039278333 8:35955921-35955943 GATACCAGGAGCAAGGTGGTGGG - Intergenic
1039306625 8:36270146-36270168 GAGAACCAGAGCAAGAGGTGGGG + Intergenic
1039309338 8:36298566-36298588 GAGCAGGAGAGCAAGGTGGGAGG + Intergenic
1039721933 8:40173819-40173841 GAGAATAAGAGAAATGTGGCCGG + Intergenic
1040383944 8:46900670-46900692 GAGACCAGGAGGAAGGTGGTGGG + Intergenic
1040383973 8:46900772-46900794 GAGACCCAGAGGAAGGTGGTGGG + Intergenic
1040581955 8:48705536-48705558 GAGAAAAACAGCCAGGAGGGAGG + Intergenic
1041234651 8:55787889-55787911 GAGAGCAAGAGAGAGGGGGGAGG + Intronic
1041515635 8:58696086-58696108 GATACCAGGAGCAAGGTGGCGGG - Intergenic
1041541847 8:58993691-58993713 GAGATCAAGGGCAGGGAGGGAGG + Intronic
1041872730 8:62653295-62653317 GAGAACCAGAGCAAGCTCTGTGG + Intronic
1041892876 8:62890973-62890995 CTGAAAGAGAGCAAGGTGGGAGG + Intronic
1041898069 8:62949153-62949175 GACAACATGTGCAAGGTGGCTGG - Intronic
1043704854 8:83335410-83335432 GAGAAGGAGAGCAAAGTGAGAGG - Intergenic
1045495195 8:102702307-102702329 AAGATCAACAGCATGGTGGGTGG - Intergenic
1045987403 8:108264567-108264589 GAGAGCAGGAGGAAGGTGGCAGG - Intronic
1046764904 8:118058925-118058947 GAGAACAAGAGAAATTTTGGAGG - Intronic
1046774009 8:118144658-118144680 AAGAACAAAAGCAAGGAAGGTGG + Intergenic
1046827085 8:118703274-118703296 GAGAACAGGTTCAAGGTGGACGG - Intergenic
1047426109 8:124748453-124748475 AAGAGCAGGAGGAAGGTGGGTGG + Intergenic
1048400767 8:134067242-134067264 GATAACAAGAGGAAGCTGGCTGG - Intergenic
1048439231 8:134447737-134447759 GAGAAGGAGAGGATGGTGGGAGG + Intergenic
1048500587 8:134971144-134971166 GAGAGCCAGAGCAAGGGTGGTGG - Intergenic
1048851238 8:138647094-138647116 TAGAAAAAGTGCAAGGTGGGGGG - Intronic
1048879430 8:138860427-138860449 GAGAAGCAGAGCAAGATGAGAGG - Intronic
1048972573 8:139653515-139653537 GAGAACAAGAGGAAAGGCGGCGG - Intronic
1051524189 9:18024415-18024437 GAGTACTAGAGGAAGGAGGGAGG - Intergenic
1051546066 9:18276707-18276729 GAGAACAGGAGCAAGAGAGGAGG + Intergenic
1052508266 9:29382124-29382146 GATACCAGGAGCAAGGTGGTGGG - Intergenic
1055395823 9:75873943-75873965 GAGGACAGTACCAAGGTGGGTGG + Intergenic
1055438825 9:76319255-76319277 GAGATCAAGACCATTGTGGGCGG + Intronic
1056040256 9:82658493-82658515 GAGAAAAGAAGGAAGGTGGGGGG + Intergenic
1056105680 9:83344031-83344053 CAGAAAAATAGCAAGGTGGGAGG + Intronic
1056159713 9:83876617-83876639 AAAAAGAAGAGCAAGGTGGGAGG + Intronic
1056163150 9:83918309-83918331 GAGAACGAGAGAAATGGGGGGGG + Intronic
1056541170 9:87572618-87572640 GAGAGCACAAGCAAGGTGAGGGG - Intronic
1056661139 9:88544242-88544264 GAGAGCAGGAGCAGGCTGGGTGG + Intronic
1058674939 9:107392362-107392384 GAGAACAAGACAGAGATGGGAGG - Intergenic
1058684541 9:107468641-107468663 AACAACATGAGCAAGGTGGGAGG + Intergenic
1058855486 9:109057955-109057977 GAAATCAAGAGAAAGGTGGAGGG - Intronic
1058901235 9:109443944-109443966 GAGGTGAAGAGCAAGGTGGCTGG - Intronic
1059811773 9:117862981-117863003 GAGAAATAGAGCAAGAGGGGAGG - Intergenic
1060407928 9:123381916-123381938 GAGACCAGGGGCAGGGTGGGTGG + Exonic
1062190685 9:135246421-135246443 GAGGACAAGAACTAGGTGGGAGG + Intergenic
1062192583 9:135255510-135255532 GGAAATATGAGCAAGGTGGGGGG + Intergenic
1062534719 9:137016422-137016444 GACAACCAGAGGCAGGTGGGTGG + Exonic
1186322099 X:8438885-8438907 GAGAGCGAGAGCAAGGGGGGAGG + Intergenic
1186870631 X:13767688-13767710 GAGAAATAGAGGAAGGAGGGAGG - Intronic
1187236856 X:17475855-17475877 GAGGCAAAGAGCAAGGTGGCTGG - Intronic
1187319578 X:18227699-18227721 GAGAAAAAGAGAGAGGAGGGAGG + Intergenic
1188576014 X:31651102-31651124 GAGATCAAGAGAAAGGTAGAAGG + Intronic
1188661524 X:32765365-32765387 CAGAACAGGAGCAAGAGGGGTGG - Intronic
1188875601 X:35426579-35426601 GAGGAAGAGAGCAAAGTGGGAGG - Intergenic
1189205548 X:39235450-39235472 AGGGAAAAGAGCAAGGTGGGGGG - Intergenic
1189723244 X:43942000-43942022 AAGAACAAGAGCAAAGAGGATGG - Intergenic
1189991439 X:46599002-46599024 GAGGCCAAGGCCAAGGTGGGTGG - Intergenic
1190187456 X:48248256-48248278 GAAAAGAAGAATAAGGTGGGAGG - Intronic
1190191949 X:48284421-48284443 GAAAAGAAGAATAAGGTGGGAGG - Intergenic
1190246304 X:48692813-48692835 GAGAAAAAGAGAAAGGTAGTGGG + Intergenic
1190314818 X:49143848-49143870 GATACCAGGAGCAAGGTGGCGGG + Intergenic
1190668053 X:52713495-52713517 AAGAAGAAGAATAAGGTGGGAGG - Intergenic
1190671364 X:52744909-52744931 AAGAAGAAGAATAAGGTGGGAGG + Intergenic
1191695273 X:63983725-63983747 GAGCAAGAGAGCAAGGTGGAAGG + Intergenic
1192207222 X:69104643-69104665 GAGTACAAGAGCATGGAGGTGGG + Intergenic
1192530733 X:71882074-71882096 ATGAAGAAGAACAAGGTGGGAGG + Intergenic
1192925288 X:75749220-75749242 GAGAATAAAAGAAGGGTGGGTGG - Intergenic
1193393211 X:80954162-80954184 GAGAGCAAGAGAAGGGAGGGAGG - Intergenic
1193975864 X:88118194-88118216 GAGAAGAAGAGAAAAGTGGAGGG - Intergenic
1194193411 X:90864786-90864808 GAGAACAAGAAAAAGCAGGGTGG + Intergenic
1195424532 X:104713435-104713457 GAAAACAAGAGTAAGGTGGAAGG - Intronic
1195615086 X:106905777-106905799 GAACACAAGTTCAAGGTGGGAGG - Intronic
1195880336 X:109586529-109586551 GAGAACAGGAGGGAGGTGGGTGG - Intergenic
1196048809 X:111283408-111283430 GCAAACAACGGCAAGGTGGGAGG + Intergenic
1196600301 X:117594050-117594072 GAGAAAAAGAACAAAGAGGGAGG + Intergenic
1196650049 X:118159293-118159315 GAGAGAAAGAGAAAGGAGGGAGG + Intergenic
1196869580 X:120099989-120100011 GATACCAGGAGCAAGGTGGCGGG - Intergenic
1197048497 X:122029372-122029394 GAGAGCAACAGGAAGGTGGAGGG + Intergenic
1197303241 X:124806832-124806854 GAGAGCAGGAGCAAGGGTGGGGG + Intronic
1197464131 X:126783038-126783060 GAGAACAACAGCATGGGGGCAGG - Intergenic
1197511004 X:127369044-127369066 GAGGAAGAGAACAAGGTGGGAGG + Intergenic
1197674398 X:129313968-129313990 GAGAGCAGGAGAAAGGTGGGGGG + Intergenic
1197823775 X:130567479-130567501 GAGGAAGAGAGCAAAGTGGGAGG - Intergenic
1198054119 X:132976901-132976923 TAGAGTAGGAGCAAGGTGGGGGG + Intergenic
1198171102 X:134105924-134105946 GAGCAAGAGAGCAGGGTGGGGGG - Intergenic
1198928737 X:141828894-141828916 GAAAACTAGAGCAAGGTGGGAGG + Intergenic
1199038104 X:143077846-143077868 GAGAGCAGGAGCAAGGTGGGAGG + Intergenic
1199329687 X:146544105-146544127 CAGAATGAGAGCAAGGTGAGGGG + Intergenic
1200115170 X:153766805-153766827 GAGGACCAGAGGAAGGTGGAAGG - Intronic
1200540022 Y:4447173-4447195 GAGAACAAGAAAAAGCAGGGTGG + Intergenic
1200958459 Y:8973630-8973652 GAGAAACAGAGCCAGGCGGGAGG - Intergenic
1201300168 Y:12498411-12498433 GAGAGAAAGAGGAAGGAGGGAGG - Intergenic
1201373023 Y:13285935-13285957 GATACCAGGAGCAAGGTGGCGGG - Intronic
1202169301 Y:22024094-22024116 GAGAACCAGAGGAAGGAGGGAGG - Intergenic
1202222060 Y:22562271-22562293 GAGAACCAGAGGAAGGAGGGAGG + Intergenic
1202321055 Y:23633396-23633418 GAGAACCAGAGGAAGGAGGGAGG - Intergenic
1202549712 Y:26036660-26036682 GAGAACCAGAGGAAGGAGGGAGG + Intergenic