ID: 962983762

View in Genome Browser
Species Human (GRCh38)
Location 3:140515308-140515330
Sequence AGACTAATTAAACCAAAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1214
Summary {0: 1, 1: 0, 2: 10, 3: 121, 4: 1082}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962983762 Original CRISPR AGACTAATTAAACCAAAAGC TGG (reversed) Intronic
900699611 1:4037164-4037186 AGATAAATCAAACAAAAAGCTGG + Intergenic
900704346 1:4070283-4070305 AGTCTATTTAAGCAAAAAGCTGG + Intergenic
900723469 1:4197100-4197122 AGATAAATGAAACAAAAAGCTGG + Intergenic
901204185 1:7484405-7484427 GGGCTAATTAACCCAAAACCAGG + Intronic
901523050 1:9800271-9800293 AAACCAACAAAACCAAAAGCTGG + Intronic
901637892 1:10678811-10678833 AAATTAATTAAAGCAAAAGGGGG - Intronic
903082581 1:20822464-20822486 AGACCAGTGAAATCAAAAGCTGG - Intronic
903893389 1:26585709-26585731 AGATTAATAATACCAAAGGCTGG - Intergenic
904728870 1:32572952-32572974 AAATCAATGAAACCAAAAGCTGG - Intronic
905288221 1:36900747-36900769 ATATCAATGAAACCAAAAGCTGG + Intronic
905496088 1:38388349-38388371 AAATCAATTAAACCAAGAGCTGG + Intergenic
905795321 1:40812852-40812874 AGACTAAGTAAATGAATAGCAGG - Intronic
905830618 1:41063492-41063514 AAAACAATGAAACCAAAAGCTGG + Intronic
905949177 1:41932619-41932641 ATATCAATCAAACCAAAAGCTGG - Intronic
906059882 1:42941653-42941675 AGACCAATTAAATCAGAATCTGG + Intronic
906808174 1:48800446-48800468 AGATAAATGAAACAAAAAGCTGG - Intronic
906910765 1:49946749-49946771 AGATAAATGAAACAAAAAGCTGG + Intronic
906955957 1:50374009-50374031 AGATAAATGAAACAAAAAGCTGG + Intergenic
907004333 1:50895076-50895098 AGATCAATGAAACTAAAAGCTGG + Intronic
907349466 1:53814646-53814668 AGATAAATGAAACAAAAAGCTGG + Intronic
907696018 1:56730219-56730241 AGATCAATGAAACAAAAAGCTGG + Intronic
908712756 1:67035632-67035654 AGATTAATGAAACAAAAAGTTGG - Intronic
908803372 1:67904073-67904095 AGACAAATGAAACAAAAAGCTGG - Intergenic
908848664 1:68351023-68351045 AGACTAAGCAGACCAGAAGCTGG + Intergenic
909235005 1:73141605-73141627 AGATAAATGAAACAAAAAGCTGG - Intergenic
909597881 1:77427196-77427218 AAACTAACAAAACCAAAAGCTGG + Intronic
909639535 1:77856823-77856845 AGAGGAATGAAACAAAAAGCTGG - Intronic
909851030 1:80464253-80464275 AGACTACTTAAACCAAATGGAGG + Intergenic
909897485 1:81090524-81090546 AAATTAATGAAACCAAAAGTTGG - Intergenic
910323730 1:85979380-85979402 AGATAAATGAAACAAAAAGCTGG + Intronic
910347844 1:86261395-86261417 AGACTTATCATACCAAATGCAGG + Intergenic
910358371 1:86389585-86389607 AGATAAATGAAACAAAAAGCTGG + Intronic
910594688 1:88967833-88967855 AAATTAATGAAACCAAAAGCTGG - Intronic
910598171 1:89002300-89002322 AGATAAATGAAACAAAAAGCTGG - Intergenic
910738711 1:90491934-90491956 AGATAAATGAAACAAAAAGCTGG - Intergenic
910984125 1:92988926-92988948 AAATTAATGAAACCAAAAGCTGG - Intergenic
911265636 1:95740054-95740076 AGATAAATGAAACAAAAAGCTGG - Intergenic
911349093 1:96730170-96730192 AGAAAACTCAAACCAAAAGCTGG - Intronic
911623504 1:100094010-100094032 AAACCAATGAAACCATAAGCCGG + Intronic
911678454 1:100686201-100686223 AGATAAATGAAACAAAAAGCTGG - Intergenic
912081451 1:105942454-105942476 AGATAAATGAAACAAAAAGCTGG - Intergenic
912127592 1:106558792-106558814 AGATCAACAAAACCAAAAGCTGG + Intergenic
912180841 1:107217392-107217414 AGATGAATGAAACAAAAAGCTGG - Intronic
912316776 1:108674730-108674752 AGATAAACTAAACCAAAAGTTGG + Intergenic
912608868 1:111022198-111022220 AGATCAATGAAACCAACAGCTGG + Intergenic
912882159 1:113425868-113425890 AAATCAATTAAACAAAAAGCTGG - Intronic
913028248 1:114868983-114869005 AAATCAATGAAACCAAAAGCTGG - Intronic
913221569 1:116664763-116664785 AGACTAACTAAACTACCAGCAGG + Intronic
913286296 1:117229814-117229836 AGACAAATTGAAGTAAAAGCTGG - Intergenic
913302228 1:117384074-117384096 AATCTAATGAAACCAAAAGTTGG - Intronic
913312793 1:117519378-117519400 AGATGAATGAAACAAAAAGCTGG + Intronic
913336622 1:117714966-117714988 AGATTAATAAAACTAAAACCTGG + Intergenic
913383654 1:118236338-118236360 AGATAAATGAAACAAAAAGCTGG + Intergenic
914219110 1:145661614-145661636 AAACTAATTAACCCAAAAGTTGG - Intronic
914346334 1:146802190-146802212 AGATAAATGAAACAAAAAGCTGG + Intergenic
914471694 1:147984485-147984507 AAACTAATTAACCCAAAAGTTGG - Intronic
916215911 1:162394357-162394379 AGATGAACAAAACCAAAAGCTGG + Intergenic
916512808 1:165488030-165488052 AGACTAATTAAATCAGAATTTGG - Intergenic
916580892 1:166107194-166107216 AGATAAATGAAACGAAAAGCTGG + Intronic
916603557 1:166317972-166317994 AAATCAATGAAACCAAAAGCTGG - Intergenic
916872899 1:168936773-168936795 AGATAAATGAAACAAAAAGCTGG - Intergenic
917163346 1:172082532-172082554 AGATTATTTAAATCAAAAACTGG - Intronic
917319263 1:173761917-173761939 AGATAAATGAAACAAAAAGCTGG + Intronic
917364309 1:174212734-174212756 AGATCAACAAAACCAAAAGCTGG + Intronic
917956233 1:180101757-180101779 AAATTAATTAAACCCAAAGGTGG - Intronic
918019163 1:180668033-180668055 AAATTAATGAAACCAAAAGTGGG - Intronic
918272262 1:182913207-182913229 AAACTAATTAAACCCAAAAAAGG + Intronic
918573737 1:186029674-186029696 AAATTAACAAAACCAAAAGCTGG - Intronic
918782578 1:188720660-188720682 AGATAAATGAAACAAAAAGCTGG + Intergenic
918950446 1:191129332-191129354 AGATCAATGAAACCAAAAGGTGG + Intergenic
919073163 1:192781665-192781687 AGAGAAATGAAACAAAAAGCTGG - Intergenic
919179777 1:194065554-194065576 AACCTAATTAACCCAAAAGAAGG - Intergenic
919407781 1:197206203-197206225 AGATAAATAAAACAAAAAGCTGG - Intergenic
919430931 1:197490719-197490741 AGAAAAATGAAACAAAAAGCTGG + Intergenic
919563670 1:199157071-199157093 AGTCTATTTAAAACAAAAGTAGG + Intergenic
919710131 1:200718390-200718412 AGATCAATAAAAACAAAAGCTGG + Intergenic
920424792 1:205866496-205866518 ATACAAATTAGACTAAAAGCAGG - Intergenic
920792120 1:209103298-209103320 AAACTAATTGAACCAACAGATGG - Intergenic
921013328 1:211163385-211163407 AGATTAATGAAACAAAAAGTTGG + Intergenic
921116461 1:212096317-212096339 AGATAAATGAAACAAAAAGCTGG - Intronic
921144567 1:212341355-212341377 AAACTAATTAAATCAAAACCAGG - Intronic
921196680 1:212764469-212764491 AGATAAATGAAACAAAAAGCTGG + Intronic
921460337 1:215418140-215418162 AAATCAATAAAACCAAAAGCCGG + Intergenic
921469149 1:215527912-215527934 ATACAAATAAAAGCAAAAGCAGG - Intergenic
921834778 1:219766921-219766943 AGATAAATGAAACAAAAAGCTGG + Intronic
921999864 1:221465960-221465982 AGATTAATGAAAGAAAAAGCTGG - Intergenic
922377350 1:224981734-224981756 AGATAAATGAAACAAAAAGCTGG - Intronic
922381186 1:225028570-225028592 AAATCAATAAAACCAAAAGCTGG - Intronic
922395753 1:225199286-225199308 AGATAAATAAAACAAAAAGCTGG - Intronic
922403317 1:225284191-225284213 ATACCAATAAAACCAAAAGTTGG + Intronic
922678683 1:227571744-227571766 AGGCTAAAGAAACAAAAAGCCGG + Intronic
922889540 1:229049993-229050015 AGATAAATGAAACAAAAAGCTGG + Intergenic
922893846 1:229084511-229084533 AAATCAATAAAACCAAAAGCTGG - Intergenic
923437694 1:233983262-233983284 AAATTAATTAAGCCAAAAGAAGG + Intronic
923459035 1:234191645-234191667 AGACAAATGAAACAAAAAGCTGG + Intronic
923486781 1:234440385-234440407 AAATCAATGAAACCAAAAGCTGG + Intronic
923558443 1:235020487-235020509 AAACTAATTAAAACAATAACAGG + Intergenic
923648504 1:235848570-235848592 AGATAAATGAAACAAAAAGCTGG + Intronic
923686475 1:236156971-236156993 GGACTAATAATACCAACAGCAGG + Intronic
923909885 1:238429673-238429695 AGATAAATGAAACAAAAAGCTGG - Intergenic
924321145 1:242852099-242852121 AGATAAATGAAACAAAAAGCTGG - Intergenic
924767754 1:247049466-247049488 AGATAAATGAAACAAAAAGCTGG - Intronic
1062981763 10:1729633-1729655 ATAATGATTAAACAAAAAGCAGG - Intronic
1063004744 10:1958424-1958446 AAATTAAGAAAACCAAAAGCAGG - Intergenic
1063277648 10:4588330-4588352 AGAGTTATTAAACAAAAAACAGG - Intergenic
1063477538 10:6342188-6342210 AGACTAATTGAAGGAAAAGGAGG - Intergenic
1063910628 10:10826072-10826094 AGAGTAATCAAACCATAAGAGGG + Intergenic
1064200399 10:13279715-13279737 AGAGTAATTAAACTAAATGTGGG + Intronic
1064556959 10:16556691-16556713 AGATAAATGAAACAAAAAGCTGG - Intergenic
1064691203 10:17920245-17920267 AGACCCATTAAACCAGAATCTGG + Intergenic
1065282820 10:24157165-24157187 AGACTAATCATACCAAAGTCTGG - Intronic
1065355537 10:24837008-24837030 ATACCAATGAAACAAAAAGCTGG + Intergenic
1065470688 10:26078449-26078471 AGATAAATGAAACAAAAAGCTGG - Intronic
1066133752 10:32421529-32421551 AAATTAATAAAACCAAAAGCTGG - Intergenic
1066145261 10:32551346-32551368 AGATAAATGAAACAAAAAGCTGG - Intronic
1066170605 10:32840195-32840217 AGATAAATGAAACAAAAAGCTGG + Intronic
1066434904 10:35388525-35388547 AAGCTCATTAAACCTAAAGCTGG - Intronic
1067022465 10:42813252-42813274 GGTCTAAATAAACCAAAAGACGG - Intronic
1067153060 10:43752219-43752241 AGACCAATTAAACCAGAATCTGG - Intergenic
1067233969 10:44432056-44432078 AGATAAATGAAACAAAAAGCTGG - Intergenic
1067898088 10:50207368-50207390 AAATCAATGAAACCAAAAGCTGG + Intronic
1068122597 10:52798600-52798622 AGATAAATGAAACAAAAAGCTGG - Intergenic
1068921500 10:62489475-62489497 AGATTCATTAAAACATAAGCAGG - Intronic
1068924727 10:62523983-62524005 AGATAAATGAAACAAAAAGCTGG - Intronic
1069215945 10:65821403-65821425 AAAATAATTAACCCAAAAGCAGG - Intergenic
1070091447 10:73289614-73289636 AGAGTAACAAAACCAAAACCTGG + Intronic
1070530789 10:77335507-77335529 AGACCAATTAAATCAGAATCTGG - Intronic
1070983190 10:80666586-80666608 AGACTAATTAAAACAATCTCTGG + Intergenic
1071015580 10:80993664-80993686 AGATAAATGAAACGAAAAGCTGG - Intergenic
1071405559 10:85327283-85327305 AGATAAATAAAACAAAAAGCTGG - Intergenic
1071484936 10:86093400-86093422 AGACAAATGAAACAAAAAGCTGG + Intronic
1071812070 10:89193527-89193549 AGATAAATGAAACAAAAAGCTGG - Intergenic
1072815171 10:98500718-98500740 AGATAAATGAAACAAAAAGCTGG + Intronic
1073228844 10:101949274-101949296 AAATCAATGAAACCAAAAGCTGG + Intronic
1073427455 10:103464361-103464383 CGACTAAATAAATAAAAAGCAGG + Intergenic
1073586361 10:104714198-104714220 AAATTAATTAAACCTAATGCTGG - Intronic
1073701206 10:105928726-105928748 AGATAAATGAAACAAAAAGCTGG + Intergenic
1073820484 10:107257322-107257344 AGATAAATGAAACAAAAAGCTGG + Intergenic
1073929085 10:108553879-108553901 ACGTCAATTAAACCAAAAGCAGG + Intergenic
1073950899 10:108808100-108808122 AAATTAATCAAACCCAAAGCAGG - Intergenic
1074194265 10:111167129-111167151 AAATCAATAAAACCAAAAGCTGG - Intergenic
1074265097 10:111893822-111893844 AAATTAATCAAACCAAAAGCAGG + Intergenic
1074985293 10:118652886-118652908 AGATAAATGAAACAAAAAGCTGG - Intergenic
1074999916 10:118788162-118788184 AGATAAATGAAACAAAAAGCTGG + Intergenic
1075490712 10:122866330-122866352 AAACCAATGAAATCAAAAGCTGG - Intronic
1075831104 10:125411887-125411909 AGACTGACCATACCAAAAGCTGG - Intergenic
1075914132 10:126151975-126151997 AGATGAATTAAACCAAAAGCTGG - Intronic
1076285007 10:129286685-129286707 AGACTGATAAAACCAAATGTTGG + Intergenic
1076537494 10:131189967-131189989 AGACCAATGAAACAAAAACCTGG + Intronic
1076665330 10:132085818-132085840 AGATAAATGAAACGAAAAGCTGG - Intergenic
1076775391 10:132693629-132693651 AAGTAAATTAAACCAAAAGCTGG + Intronic
1077275272 11:1702906-1702928 AAATTAATTAAACCAAAATCTGG + Intergenic
1077482078 11:2820027-2820049 TGACCAATAAAACCAAATGCAGG - Intronic
1078191822 11:9097455-9097477 ATACAAATTAGGCCAAAAGCAGG + Intronic
1078288907 11:9986476-9986498 AGATAAATGAAACAAAAAGCTGG + Intronic
1078411709 11:11126723-11126745 AGATTAATGAAACAAAAAGCTGG - Intergenic
1078472146 11:11598034-11598056 AGATCAATAAAACCAAAAGTTGG - Intronic
1078687037 11:13542674-13542696 AGATAAATGAAACAAAAAGCTGG - Intergenic
1078991450 11:16650818-16650840 AGATAAATGAAACAAAAAGCCGG + Intronic
1079174808 11:18129230-18129252 AGATAAATGAAACAAAAAGCTGG + Intronic
1079207791 11:18431915-18431937 AGATAAATGAAACAAAAAGCTGG - Intronic
1079550558 11:21692099-21692121 AGAACAAATAAACCTAAAGCGGG + Intergenic
1079824239 11:25170803-25170825 AGATTAATAAAATTAAAAGCTGG - Intergenic
1079956454 11:26872225-26872247 AGATAAATGAAACAAAAAGCTGG + Intergenic
1080145245 11:28974959-28974981 AAACCAACAAAACCAAAAGCTGG - Intergenic
1080152266 11:29066838-29066860 AGATTAATGAAAACAAAAGTTGG + Intergenic
1080255270 11:30283250-30283272 AAGCAAATTAAACCAAAAGTTGG + Intergenic
1080324387 11:31053027-31053049 AGATAAATGAAACAAAAAGCTGG + Intronic
1080585620 11:33679794-33679816 AGATAAATGAAACAAAAAGCTGG - Intergenic
1080723558 11:34872618-34872640 AGGCTAATTAAACCCAAGGAGGG + Intronic
1080748885 11:35134573-35134595 AGTCTAAATAAACCAGTAGCTGG - Intergenic
1080838275 11:35960892-35960914 AGGCAAATTAAAACCAAAGCAGG - Intronic
1081011578 11:37819800-37819822 AGACAAGTAAAATCAAAAGCTGG + Intergenic
1081293297 11:41353071-41353093 AGATCAATAAAACCAAAAGTTGG + Intronic
1081349301 11:42029461-42029483 AAATTAATAAAACCAACAGCTGG + Intergenic
1081368726 11:42271651-42271673 AGAGTGACAAAACCAAAAGCTGG + Intergenic
1082193293 11:49272898-49272920 AGATTAATGAAACAAAAAGCGGG - Intergenic
1083046449 11:59740298-59740320 AGATAAATGAAACAAAAAGCTGG - Intronic
1083494970 11:63043450-63043472 AGATAATTGAAACCAAAAGCTGG + Intergenic
1083525188 11:63357683-63357705 AGACTAATGAAACCAAGAGTTGG - Intronic
1083740100 11:64705187-64705209 AGCCCAAATAAACCAAATGCAGG + Intronic
1084011888 11:66355711-66355733 AAATTAATGAAACCAAAAGTTGG - Intronic
1084152533 11:67297000-67297022 AAATTAATGAAACCAAAAACTGG - Intronic
1084368791 11:68723605-68723627 AAATCAATAAAACCAAAAGCTGG + Intronic
1084873277 11:72112115-72112137 AGATAAATTAAGACAAAAGCAGG - Intronic
1085223745 11:74899454-74899476 AGACCAATGAAACAAAAAGTTGG + Intronic
1085452705 11:76645064-76645086 AGATTAATTAAACCTAAGGAGGG + Intergenic
1086014607 11:82151722-82151744 AGACTGACTAAACCAAATGTTGG - Intergenic
1086028980 11:82329755-82329777 AGAATAAATAAACCCAAAGCAGG + Intergenic
1086082585 11:82920323-82920345 AGATACATGAAACCAAAAGCTGG - Intronic
1086264847 11:84985670-84985692 AGATAAATGAAACAAAAAGCAGG + Intronic
1086320947 11:85647198-85647220 GGACTAATTAACCCAATAGAAGG - Intergenic
1087031573 11:93710986-93711008 AGACTAATTACAAAAAAAGAAGG - Intronic
1087106105 11:94408842-94408864 AGATAAATGAAACAAAAAGCTGG + Intergenic
1087333252 11:96810905-96810927 AAATTAATTGAACCAAAAGATGG + Intergenic
1087367894 11:97244802-97244824 AGATCAATGAAACCAAAAGTTGG - Intergenic
1087637962 11:100724753-100724775 AAATCAATGAAACCAAAAGCTGG - Intronic
1087649031 11:100843009-100843031 AGATAAATGAAACAAAAAGCTGG + Intronic
1087720522 11:101660172-101660194 AGATCAATTAAACAAAAAGTTGG - Intronic
1087791986 11:102415869-102415891 AGATCAATGAAACCAAAAGTTGG + Intronic
1088239946 11:107763116-107763138 AGACAAATGAAACAAAAAGCTGG + Intergenic
1088580848 11:111314717-111314739 AGATAAATGAAACAAAAAGCTGG + Intergenic
1088726288 11:112638332-112638354 AGACTGATTATACCAAAAGCTGG - Intergenic
1088929482 11:114336509-114336531 AAATCAATAAAACCAAAAGCTGG + Intergenic
1089107649 11:116026835-116026857 AGATAAATGAAACAAAAAGCTGG + Intergenic
1089274289 11:117323746-117323768 AGACAAAGGAAAACAAAAGCTGG - Intronic
1089970561 11:122689775-122689797 AAATTAATTGAACCAAAAGAGGG - Intronic
1090316552 11:125795289-125795311 AGATCAATGAAACCAAAAGTTGG - Intergenic
1090538055 11:127667751-127667773 AAATTAATGAAACTAAAAGCTGG + Intergenic
1090688480 11:129151917-129151939 AGATAAATGAAGCCAAAAGCTGG + Intronic
1090742370 11:129676566-129676588 AGATCAATAAAACCAAAAGATGG + Intergenic
1091506547 12:1074961-1074983 AGACTAATCTAAACACAAGCAGG - Intronic
1091593933 12:1862367-1862389 AGACTAATAACACCAAATACTGG - Intronic
1091728372 12:2861507-2861529 AGACTAATAATACCAATTGCTGG + Intronic
1091983746 12:4889868-4889890 AGTGAAATTAAACCACAAGCTGG + Intergenic
1092303581 12:7276682-7276704 AGATAAATGAAACAAAAAGCTGG - Intergenic
1092316333 12:7418574-7418596 AGATGAATGAAACAAAAAGCTGG + Intronic
1092953525 12:13529195-13529217 AGACTGGTTAAACCCAAAGTTGG - Intergenic
1093389860 12:18605081-18605103 AGATGAATGAAACAAAAAGCTGG + Intronic
1093408948 12:18842187-18842209 AGATAAATGAAACAAAAAGCTGG - Intergenic
1093496766 12:19766596-19766618 AGATCAATGAAACCAAAAGTTGG + Intergenic
1093951850 12:25171167-25171189 AGATAAATGAAACAAAAAGCTGG + Intronic
1093991688 12:25595781-25595803 AGATAAATGAAACAAAAAGCTGG + Intronic
1094254314 12:28403972-28403994 AAATCAATAAAACCAAAAGCTGG - Intronic
1094742297 12:33303527-33303549 AAACTAATCAAACCCAAAGAGGG + Intergenic
1094778548 12:33762145-33762167 AGATAAATGAAACAAAAAGCTGG + Intergenic
1095115472 12:38346609-38346631 AGATAAATGAAACAAAAAGCTGG + Intergenic
1095117978 12:38379078-38379100 AGATAAATGAAACAAAAAGCTGG - Intergenic
1095259168 12:40079073-40079095 AGATTGATGAAACCAAAAGTTGG - Intronic
1095500781 12:42836388-42836410 AGATAAATGAAACCAAAAGCAGG - Intergenic
1095687682 12:45053601-45053623 AGATAAATGAAACAAAAAGCTGG + Intergenic
1095733020 12:45525655-45525677 AGACAAATGAAACAAAAAGCCGG + Intergenic
1095756531 12:45773436-45773458 AAATTAGTTAAATCAAAAGCTGG + Intronic
1095932330 12:47639865-47639887 AGATAAATGAAACAAAAAGCTGG + Intergenic
1096888332 12:54740929-54740951 AGATAAATAAAACAAAAAGCTGG - Intergenic
1096956693 12:55533778-55533800 AGATAAATGAAACAAAAAGCTGG + Intergenic
1097295775 12:57960966-57960988 AGATAAATGAAACAAAAAGCTGG + Intergenic
1097344946 12:58480693-58480715 ACAATACTTAAACAAAAAGCAGG - Intergenic
1097385646 12:58947390-58947412 AGATAAATGAAACAAAAAGCTGG - Intergenic
1097906727 12:64927625-64927647 AGATGAATAAAACAAAAAGCTGG - Intergenic
1097928862 12:65162107-65162129 AGTCTTATTAAACCAAAACCTGG + Intergenic
1098319523 12:69227706-69227728 AGATTAATGAAACAAAAAGCTGG + Intergenic
1098500867 12:71190259-71190281 AGATAAATGAAACAAAAAGCTGG + Intronic
1098832850 12:75384203-75384225 AAATTAATAAAATCAAAAGCTGG + Intronic
1098852498 12:75613815-75613837 AGATAAATGAAACAAAAAGCTGG + Intergenic
1098982417 12:76971506-76971528 AGATAAATGAAACAAAAAGCTGG - Intergenic
1099042210 12:77669993-77670015 AGATAAATGAAACAAAAAGCTGG + Intergenic
1099197094 12:79630136-79630158 AAAATAATGAAACCAAAAGTGGG + Intronic
1099849570 12:88074995-88075017 AAATTAATCAAACCCAAAGCTGG + Intronic
1099907332 12:88787835-88787857 AAATTAATGAAACCAAAAGCTGG + Intergenic
1099938888 12:89161214-89161236 AGAGAAATTCAACCAAAATCTGG + Intergenic
1100421554 12:94439226-94439248 AGATAAATTAGACAAAAAGCTGG + Intronic
1100758103 12:97774500-97774522 AAACTAAATAAACCAAAAACTGG + Intergenic
1101018386 12:100526116-100526138 AAACCAGTGAAACCAAAAGCTGG - Intronic
1101024422 12:100586769-100586791 AGATAAATGAAACAAAAAGCTGG + Intronic
1101274433 12:103183516-103183538 CAATTAATGAAACCAAAAGCTGG - Intergenic
1101313327 12:103604787-103604809 AAATAAATGAAACCAAAAGCTGG - Intronic
1101582138 12:106050892-106050914 AAATTAATTAAACCCAAAACAGG - Intergenic
1103227992 12:119304463-119304485 AGACTAATCAAATCCAAAGTGGG - Intergenic
1103281776 12:119763995-119764017 AAACTAAGTAAAACAGAAGCAGG + Intronic
1104504229 12:129316088-129316110 AGACAAATGAAACAAAAAGCTGG - Intronic
1104524345 12:129504668-129504690 AGATAAATGAAACAAAAAGCTGG - Intronic
1104687687 12:130798958-130798980 ATACTAGTTCAACCAAAAGCTGG - Intronic
1105205930 13:18224122-18224144 AAATCAATAAAACCAAAAGCTGG - Intergenic
1105315190 13:19252802-19252824 AGATAAATGAAACAAAAAGCTGG + Intergenic
1106281419 13:28276152-28276174 AGACTAATTATACCAAAATTGGG + Intronic
1106921685 13:34570836-34570858 GGATTAATTAAGCCAAGAGCTGG + Intergenic
1107311869 13:39087078-39087100 AAATTAATGAAACCAAAAGCTGG + Intergenic
1107341745 13:39414541-39414563 AGACTGATAACACCAAATGCAGG - Intronic
1107700880 13:43046543-43046565 ATACAAATTAAGCTAAAAGCAGG + Intronic
1107780817 13:43900624-43900646 AGACCAATTAAATCAGAATCTGG + Intergenic
1108039155 13:46323374-46323396 AGACTGATGATACCAAATGCTGG - Intergenic
1108134601 13:47341973-47341995 AGATAAATGAAACAAAAAGCTGG + Intergenic
1108189287 13:47920856-47920878 AGATAAATGAAACAAAAAGCTGG + Intergenic
1108194359 13:47976925-47976947 AGAATAACTAAACCCAAAGTTGG + Intronic
1108274949 13:48798735-48798757 ACACAAATAAAACCAAAATCAGG + Intergenic
1108469206 13:50751880-50751902 AGATAAATGAAACAAAAAGCTGG - Intronic
1108831907 13:54489782-54489804 AGACAAATGAAACAAAAAGCTGG + Intergenic
1108990472 13:56650318-56650340 AGATCAATGAAACCAAAAGTGGG + Intergenic
1109125389 13:58511298-58511320 AGATAAATGAAACGAAAAGCTGG + Intergenic
1109213323 13:59560326-59560348 AGATAAATGAAACAAAAAGCTGG - Intergenic
1109922522 13:69087564-69087586 AAATCAATGAAACCAAAAGCTGG + Intergenic
1110082441 13:71332543-71332565 AGATTAATTAAACCAAGATCTGG + Intergenic
1110182077 13:72629168-72629190 AGATAAATAAAACAAAAAGCTGG + Intergenic
1110340671 13:74386198-74386220 AGATAAATGAAACAAAAAGCTGG - Intergenic
1110887980 13:80662204-80662226 AGATCAATGAAACAAAAAGCTGG - Intergenic
1111165501 13:84452763-84452785 AGATAAATGAAACAAAAAGCTGG - Intergenic
1111225875 13:85269969-85269991 AGATAAATTAAACAAAAAGCTGG + Intergenic
1111393619 13:87633379-87633401 AGATCAATGACACCAAAAGCTGG - Intergenic
1111518749 13:89370758-89370780 AAACTAATTAAACAAAAAGTAGG + Intergenic
1111988689 13:95092772-95092794 AGATAAATAAAACAAAAAGCTGG + Intronic
1112171694 13:96979065-96979087 AAAGTAATAAAACCAAATGCTGG + Intergenic
1112945579 13:104922842-104922864 AGATAAATGAAACAAAAAGCTGG + Intergenic
1113855167 13:113440024-113440046 AAATTAATAAAACCAAAAGCTGG - Intronic
1114968292 14:27992585-27992607 AAATCAATAAAACCAAAAGCTGG - Intergenic
1115200354 14:30847119-30847141 AGATTAATGAAACCAAAAGTTGG - Intergenic
1115448600 14:33520042-33520064 CAACTAATTAAACCAGAAGCAGG - Intronic
1116335768 14:43654331-43654353 AGATAAATGAAACAAAAAGCTGG + Intergenic
1116406324 14:44570852-44570874 AGACAAATGAAACAAAAAGTTGG + Intergenic
1116580430 14:46634229-46634251 AGAGCAATGAAACCAAAAGTTGG - Intergenic
1117064056 14:51991183-51991205 AAATTAATTGAACCAAAAGAGGG - Intronic
1117102461 14:52364399-52364421 AGACAAATAAAACCAAGAGCAGG + Intergenic
1117103547 14:52375585-52375607 AGATAAATGAAACAAAAAGCTGG - Intergenic
1117113033 14:52478370-52478392 AGATAAATGAAACAAAAAGCTGG + Intronic
1117182507 14:53205744-53205766 AGAGAAATAAAACAAAAAGCTGG + Intergenic
1117317585 14:54588326-54588348 AGATAAATGAAACAAAAAGCTGG - Intronic
1117587389 14:57224270-57224292 AAATTAATGAAACCAAAAGCTGG + Intronic
1117801856 14:59452573-59452595 ACACTAATAACACCAAATGCTGG + Intronic
1118162566 14:63304884-63304906 AGATAAATGAAACAAAAAGCAGG + Intergenic
1118423857 14:65636287-65636309 AGATAAATGAAACAAAAAGCAGG - Intronic
1118652069 14:67907179-67907201 AGATCAACAAAACCAAAAGCTGG - Intronic
1118662121 14:68025811-68025833 AGATCAATAAAACCAACAGCTGG - Intronic
1118727836 14:68642554-68642576 AAATGAATAAAACCAAAAGCTGG - Intronic
1119280280 14:73400958-73400980 AAATTAATTGAACCAAAAGAGGG + Intronic
1120097346 14:80403629-80403651 ATACCAATTAGGCCAAAAGCAGG + Intergenic
1120736097 14:88054689-88054711 AGATAAATGAAACAAAAAGCTGG - Intergenic
1121246342 14:92463606-92463628 AGACAAATTAGAACAAAACCTGG + Intronic
1121458736 14:94056634-94056656 AAATTAATTGAACCCAAAGCGGG + Intronic
1121503212 14:94455963-94455985 AGATAAATGAAACAAAAAGCTGG - Intergenic
1122747023 14:103903874-103903896 AGATCAATGAAACCAAAAGCTGG - Intergenic
1122776971 14:104121910-104121932 AAATCAATAAAACCAAAAGCTGG - Intergenic
1122806300 14:104261039-104261061 AAATCAATGAAACCAAAAGCTGG + Intergenic
1123104001 14:105828552-105828574 AGATAAATGAAACAAAAAGCTGG - Intergenic
1124386494 15:29212426-29212448 AGATAAATGAAACAAAAAGCCGG - Intronic
1124643445 15:31415841-31415863 AAATTGATAAAACCAAAAGCTGG + Intronic
1124668120 15:31611353-31611375 AGATAAATGAAACAAAAAGCTGG + Intronic
1124842755 15:33259020-33259042 AAACTAATTTCACCAAAAGCTGG - Intergenic
1125269100 15:37918562-37918584 AGATAAATGAAACGAAAAGCTGG - Intergenic
1125273194 15:37962988-37963010 AGATAAATGAAACAAAAAGCTGG - Intronic
1125569331 15:40703771-40703793 AAATCAATGAAACCAAAAGCTGG - Intronic
1126241398 15:46448709-46448731 AGAATAAAAGAACCAAAAGCAGG - Intergenic
1126458211 15:48887694-48887716 AAATTAATTAAACCAAAAGTTGG + Intronic
1126504338 15:49386694-49386716 AGATCAATGAAACAAAAAGCTGG + Intronic
1126577804 15:50214008-50214030 AGATAAATGAAACAAAAAGCTGG + Intronic
1126733462 15:51708470-51708492 AGACCAATTAAATCAGAATCTGG - Intronic
1126880357 15:53088279-53088301 GGATCAATAAAACCAAAAGCTGG - Intergenic
1126981865 15:54253536-54253558 GAACTAATTAAAGAAAAAGCAGG - Intronic
1126998236 15:54470692-54470714 AGACTAATGAAACAAAAAATTGG - Intronic
1127090481 15:55461828-55461850 AGAAAAATTAAACAAAATGCTGG + Intronic
1127491023 15:59463781-59463803 AAATTAATAAAACCAAAAGTTGG - Intronic
1128073453 15:64811515-64811537 AAATTAATCAAACCAAAAGAGGG + Intergenic
1129928820 15:79391030-79391052 AGATAAATGAAACAAAAAGCTGG - Intronic
1129950480 15:79584517-79584539 AAACAAACTAAACCGAAAGCTGG - Intergenic
1130359426 15:83168349-83168371 GGATCAATGAAACCAAAAGCTGG + Intronic
1130544972 15:84849899-84849921 AAAATAATGAAACCAAAAACAGG + Intronic
1130637400 15:85637576-85637598 AAATCAATGAAACCAAAAGCTGG - Intronic
1131091515 15:89628050-89628072 AGACCATTTAAACCACAACCTGG + Exonic
1131414200 15:92238289-92238311 AGATCAATGAAACAAAAAGCTGG + Intergenic
1132033662 15:98460672-98460694 AGATAAATGAAACAAAAAGCTGG + Intronic
1133182038 16:4063850-4063872 AAACTGATGAAACCAAAAGTTGG + Intronic
1133952871 16:10411981-10412003 AGATAAATGAAACAAAAAGCTGG - Intronic
1134421929 16:14101002-14101024 AAAATCAATAAACCAAAAGCTGG - Intronic
1135901907 16:26467953-26467975 AGATAAATGAAACGAAAAGCTGG + Intergenic
1135917621 16:26619954-26619976 AGATAAATGAAACAAAAAGCTGG - Intergenic
1136687796 16:32005468-32005490 AAAGCAATGAAACCAAAAGCTGG + Intergenic
1136729691 16:32398230-32398252 AGATAAATGAAACTAAAAGCTGG - Intergenic
1136788399 16:32949023-32949045 AAAGCAATGAAACCAAAAGCTGG + Intergenic
1136881416 16:33904908-33904930 AAAGCAATGAAACCAAAAGCTGG - Intergenic
1137358883 16:47793923-47793945 AGAATAATGAAACCACAAGTTGG - Intergenic
1138355610 16:56376789-56376811 AAATCAATGAAACCAAAAGCCGG + Intronic
1138518455 16:57554310-57554332 AAATTAATGAAACCAAAAGCTGG - Intronic
1138569109 16:57856594-57856616 AAACCAATAAACCCAAAAGCTGG + Intronic
1138592336 16:58008279-58008301 AAATCAATAAAACCAAAAGCTGG - Intronic
1138690539 16:58764379-58764401 AAAACAATGAAACCAAAAGCTGG - Intergenic
1139024146 16:62793029-62793051 AGATCAATGAAACAAAAAGCTGG - Intergenic
1139051289 16:63128003-63128025 AAATTAATAAAATCAAAAGCTGG + Intergenic
1139765428 16:69224832-69224854 AAAGTAATAAAAACAAAAGCTGG - Intronic
1139809047 16:69597225-69597247 AGATTCGGTAAACCAAAAGCTGG + Intronic
1139987645 16:70913078-70913100 AGATAAATGAAACAAAAAGCTGG - Intronic
1141060634 16:80865353-80865375 AGACCAATGAAACCAAGAGTTGG + Intergenic
1141507608 16:84488968-84488990 AAATTAATGAAACTAAAAGCTGG + Intronic
1202996705 16_KI270728v1_random:119074-119096 AGATAAATGAAACTAAAAGCTGG + Intergenic
1203023392 16_KI270728v1_random:431416-431438 AGATAAATGAAACTAAAAGCTGG + Intergenic
1203090599 16_KI270728v1_random:1210538-1210560 AAAGCAATGAAACCAAAAGCTGG + Intergenic
1142817942 17:2442554-2442576 AGAATGATGAAACCAAGAGCTGG + Intronic
1142939446 17:3370471-3370493 AGATAAATGAAACAAAAAGCTGG - Intergenic
1144139399 17:12333770-12333792 AGATAAATGAAACAAAAAGCTGG - Intergenic
1144245700 17:13362142-13362164 AAACCAGTGAAACCAAAAGCTGG + Intergenic
1144437245 17:15252953-15252975 ACACAAATTAAACAAAAAGCAGG + Intronic
1144488828 17:15689886-15689908 AGACTATTGAAACCAAAAGCTGG - Intergenic
1144896365 17:18537757-18537779 AGATAAATGAAACAAAAAGCTGG - Intergenic
1144912190 17:18692414-18692436 AGACTATTGAAAGCAAAAGCTGG + Intergenic
1145033221 17:19521055-19521077 AAACCAACAAAACCAAAAGCTGG - Intronic
1145135851 17:20406460-20406482 AGATAAATGAAACAAAAAGCTGG + Intergenic
1145372295 17:22316948-22316970 TACTTAATTAAACCAAAAGCTGG + Intergenic
1146583660 17:34062564-34062586 AGATAAATGAAACAAAAAGCTGG + Intronic
1147148781 17:38501143-38501165 AAAGCAATGAAACCAAAAGCTGG + Intronic
1148407981 17:47436718-47436740 AGATAAATGAAACAAAAAGCTGG - Intronic
1149022419 17:51984554-51984576 AGATAAATGAAACAAAAAGCTGG + Intronic
1149052857 17:52326898-52326920 AGATAAATGAAACAAAAAGCTGG + Intergenic
1149770932 17:59320242-59320264 ATAATAATTAAAGCATAAGCAGG - Intergenic
1149929573 17:60737338-60737360 AGATCAATGAAACCAAAAGCTGG - Intronic
1150511827 17:65761188-65761210 AAATCAATGAAACCAAAAGCTGG - Intronic
1150512567 17:65772298-65772320 AAATTAATGAAACCAAAAGCTGG + Intronic
1150892745 17:69172781-69172803 AAACTCATTAAATTAAAAGCAGG + Intronic
1151017806 17:70577353-70577375 ATACAAATTAGACTAAAAGCAGG + Intergenic
1151048656 17:70950663-70950685 AGATAAATGAAACAAAAAGCTGG + Intergenic
1151079071 17:71307645-71307667 AGATAAATGAAACAAAAAGCTGG + Intergenic
1153069225 18:1086495-1086517 AGATAAATGAAACAAAAAGCTGG - Intergenic
1153079649 18:1207723-1207745 AGAAAAATGAAACAAAAAGCTGG - Intergenic
1153134182 18:1894790-1894812 AGATTAATTATAGAAAAAGCCGG + Intergenic
1153173387 18:2342560-2342582 AAATTAATGAAACCAAAAGTTGG + Intergenic
1153177077 18:2388571-2388593 AAATTAATCAAACCAAAAGTTGG + Intergenic
1153268974 18:3300100-3300122 AGATTAATGAAACAAAAAGTTGG + Intergenic
1153402140 18:4692540-4692562 AGACAAATGAAACAAAAAGCTGG + Intergenic
1153702389 18:7709599-7709621 AGATAAATGAAACAAAAAGCTGG + Intronic
1153792370 18:8590587-8590609 AAATCAATGAAACCAAAAGCTGG + Intergenic
1153897727 18:9582228-9582250 AAACCAATGAAACCAAAAGTTGG + Intronic
1154033065 18:10770529-10770551 ACACTAATTTAATCAAAAGGTGG - Intronic
1154090259 18:11352278-11352300 AGATAAATTAAACAAAAAGCTGG + Intergenic
1154314178 18:13291051-13291073 AAACTAAATAAACCTAAAACAGG + Intronic
1155023728 18:21921677-21921699 AGACTTTTTAAAATAAAAGCAGG - Intergenic
1155484117 18:26322689-26322711 AAATTAATAAAACCAAAAGTTGG - Intronic
1155641190 18:28017559-28017581 AGATAAATGAAACAAAAAGCTGG - Intronic
1156003673 18:32414902-32414924 ATACCAATTAAACGAAAAGTTGG + Intronic
1156011002 18:32498003-32498025 AGATAAATGAAACAAAAAGCTGG - Intergenic
1156094980 18:33518714-33518736 GAATTAATGAAACCAAAAGCTGG + Intergenic
1156132565 18:33994836-33994858 AAACGAATAAAATCAAAAGCTGG + Intronic
1156562399 18:38140822-38140844 AAATTAATGAAAACAAAAGCTGG - Intergenic
1156564242 18:38165614-38165636 AGACTGAATAAACAAAAAGGTGG - Intergenic
1156771099 18:40727062-40727084 AGACTAATGAAACCAAATGGGGG + Intergenic
1157373424 18:47139556-47139578 AAACTAATCAAACCCAAAGTGGG + Intronic
1157507753 18:48241891-48241913 AGATAAATGAAACTAAAAGCTGG + Intronic
1157853968 18:51086558-51086580 ATACTAATTAAAAGAAATGCTGG + Intergenic
1157968191 18:52234028-52234050 AAATTTATTAAACCAAAACCTGG + Intergenic
1158331395 18:56367270-56367292 AGATAAATGAAACAAAAAGCTGG - Intergenic
1158756778 18:60334617-60334639 AGATAAATGAAACAAAAAGCTGG + Intergenic
1158793823 18:60816834-60816856 AAATTAATGAAACCAACAGCTGG - Intergenic
1158800348 18:60900178-60900200 AGACAAATTAAAACAATAGATGG + Intergenic
1158986240 18:62820185-62820207 AGTATAAATAAATCAAAAGCTGG + Intronic
1159035162 18:63270058-63270080 GGGCAAATTAAACCATAAGCTGG + Intronic
1159104669 18:63992547-63992569 AAATCAATGAAACCAAAAGCTGG - Intronic
1159440673 18:68476199-68476221 AGAGAAATTAAACCTAAAGACGG + Intergenic
1159773281 18:72574486-72574508 AAAATAATTATATCAAAAGCAGG + Intronic
1159971394 18:74658667-74658689 ATTCTAATTAAAACAAAAGTAGG - Intronic
1160275640 18:77431349-77431371 AAATTGATGAAACCAAAAGCTGG - Intergenic
1160582318 18:79891005-79891027 AAACCAATGAAACCAAAGGCTGG - Intronic
1162616945 19:11809514-11809536 AGAATAAGTAAAGCAAAAACAGG - Intronic
1163292733 19:16391268-16391290 AGAAAAATGAAGCCAAAAGCTGG + Intronic
1164451809 19:28372596-28372618 AAACTAATCAAACCCAAAGAGGG + Intergenic
1164894127 19:31854981-31855003 AAATTAATAAAACCAAAAGGTGG + Intergenic
1165303566 19:34989062-34989084 AGACTAAAAAAAAAAAAAGCTGG - Intergenic
1165572563 19:36787683-36787705 TACCTAATTAAACTAAAAGCTGG - Intergenic
1166200180 19:41232319-41232341 AGAATAAGAAAACCAAAACCAGG + Intronic
1166603981 19:44123939-44123961 AGATAAATGAAACAAAAAGCTGG - Intronic
1167851211 19:52203834-52203856 AGCCTAATCAAACCCAAAGAGGG - Intronic
1168395813 19:56047187-56047209 AGATAAATGAAACAAAAAGCTGG - Intronic
925652031 2:6101062-6101084 AGATGAATGAAACAAAAAGCTGG - Intergenic
925680785 2:6419396-6419418 AAACTAGTTTAAACAAAAGCAGG - Intergenic
925795453 2:7536935-7536957 AGATAAATGAAACAAAAAGCTGG - Intergenic
926235272 2:11037557-11037579 AGATCAATGAAACAAAAAGCTGG - Intergenic
926463256 2:13160061-13160083 AGACTAATTAAATAAAAAGATGG + Intergenic
926560449 2:14411206-14411228 AGATAAATGAAACAAAAAGCTGG + Intergenic
926866738 2:17367927-17367949 AGATAAATGAAACAAAAAGCTGG - Intergenic
926915734 2:17890371-17890393 AGATAAATGAAACAAAAAGCTGG - Intronic
927006733 2:18858465-18858487 AGATTAACAAAACAAAAAGCTGG - Intergenic
927069650 2:19514076-19514098 AGATAAATGAAACAAAAAGCTGG - Intergenic
927570695 2:24156786-24156808 AGATAAATGAAACAAAAAGCTGG - Intronic
927617106 2:24609649-24609671 AGAATAATTAAACCAAAAGTTGG - Intronic
928047159 2:27947235-27947257 ATATTAATTAATCCAAAAGAAGG - Intronic
928047472 2:27951108-27951130 AGATGGATGAAACCAAAAGCTGG - Intronic
928356958 2:30625277-30625299 AGATAAATGAAACAAAAAGCTGG + Intronic
928408789 2:31037686-31037708 AGAGTCACTAAACCACAAGCAGG - Intronic
928490096 2:31774256-31774278 AAATTAATGAAACCAAAAGTTGG + Intergenic
928494972 2:31822444-31822466 AGACCAATGAAACAAAAAGTTGG - Intergenic
928733972 2:34264192-34264214 AGATAAATGAAACAAAAAGCTGG + Intergenic
928831359 2:35488995-35489017 AAGTTAATGAAACCAAAAGCAGG + Intergenic
928856237 2:35805843-35805865 AGATAAATGAAACAAAAAGCTGG + Intergenic
928948356 2:36792115-36792137 AGACCTATTAAACCAGAATCTGG + Intronic
928988726 2:37207842-37207864 AGATAAATGAAACAAAAAGCTGG + Intronic
929010019 2:37432314-37432336 AGACAAATAAAACAAAAAGCTGG - Intergenic
929037072 2:37704158-37704180 AGATAAATGAAACAAAAAGCTGG - Intronic
929650230 2:43672323-43672345 AAATCAATAAAACCAAAAGCTGG - Intronic
929722641 2:44386459-44386481 AGACAAATGAAAGAAAAAGCTGG - Intronic
929807352 2:45158634-45158656 AGAATAATTCAAACAACAGCGGG - Intergenic
929818874 2:45257883-45257905 CTGCTAATTAATCCAAAAGCTGG - Intergenic
930499795 2:52199722-52199744 AGACCAATGAAACAAAAAGTTGG + Intergenic
930919908 2:56740286-56740308 AGATTAATAAAACAAAAAGTTGG - Intergenic
931136235 2:59404844-59404866 AGATAAATAAAACAAAAAGCTGG + Intergenic
931210244 2:60187160-60187182 AAAATAACAAAACCAAAAGCTGG + Intergenic
931481267 2:62643234-62643256 AGGCTAAGGCAACCAAAAGCTGG - Intergenic
931533444 2:63244409-63244431 AGATCAATGAAACCAAAAGTTGG + Intronic
931557932 2:63525589-63525611 ACACTAAGAAAACCAATAGCTGG - Intronic
931834891 2:66088468-66088490 AGATAAATGAAACAAAAAGCTGG + Intergenic
931929911 2:67120431-67120453 AAATTAATGAAACCCAAAGCTGG - Intergenic
931993148 2:67810742-67810764 AGATAAATGAAACAAAAAGCTGG + Intergenic
932561153 2:72871470-72871492 AAATTAATAAAACCAGAAGCTGG + Intergenic
932954375 2:76334613-76334635 AGATAAATGAAACAAAAAGCTGG - Intergenic
933410987 2:81924867-81924889 AGATAAATGAAACAAAAAGCTGG + Intergenic
933474611 2:82773679-82773701 AGATTAATGAAACAAAAAGCTGG + Intergenic
933617858 2:84501973-84501995 AGACCAATGAAACAAAAAGTTGG - Intergenic
934185993 2:89676267-89676289 AGATAAATGAAACTAAAAGCTGG - Intergenic
934651887 2:96097321-96097343 AGACCAATAACACCAAATGCTGG + Intergenic
935000972 2:99014683-99014705 AGATAAATCAAACAAAAAGCTGG + Intronic
935602905 2:104940646-104940668 AGATTAATTAAACAAAACGAAGG + Intergenic
935609177 2:105003150-105003172 AGTCTTATAAAACCAAAAACAGG + Intergenic
936120630 2:109740492-109740514 AGACTACTTCATCCAAGAGCAGG + Intergenic
936224067 2:110630968-110630990 AGACTACTTCATCCAAGAGCAGG - Intergenic
936237948 2:110761165-110761187 TAACTAATAAATCCAAAAGCTGG - Intronic
936555174 2:113490527-113490549 AGATAAATGAAACAAAAAGCTGG + Intronic
936942168 2:117895398-117895420 AGACCAATGAAACCAAAAGCAGG - Intergenic
936994783 2:118402130-118402152 AGGTCAATTAAACCAAAAGTTGG - Intergenic
937058130 2:118957180-118957202 AGATAAATGAAACAAAAAGCTGG + Intronic
937716087 2:125034760-125034782 AGATAAATGAAACAAAAAGCTGG - Intergenic
937756756 2:125548687-125548709 AGATTAAAGAAACCAAAAGGTGG + Intergenic
937781703 2:125846128-125846150 AGATAAATGAAACAAAAAGCTGG - Intergenic
937798672 2:126055915-126055937 AGATAAATGAAACTAAAAGCTGG - Intergenic
938175335 2:129121292-129121314 AGATAAATGAAACAAAAAGCTGG - Intergenic
938674801 2:133621317-133621339 AGATAAATCAAACAAAAAGCTGG + Intergenic
938968310 2:136407783-136407805 ACACTAATTAGTGCAAAAGCAGG + Intergenic
939051055 2:137308329-137308351 AGACTAATCAGACAATAAGCTGG - Intronic
939149757 2:138459277-138459299 AGACAAATGAAACAAAAAACTGG + Intergenic
939171787 2:138704557-138704579 AGACCAATTAAATCAGAAGGAGG + Intronic
939579385 2:143930257-143930279 AGACTATTTCCACCAAAAGATGG - Intergenic
939769828 2:146301583-146301605 AGATAAATGAAACCAAAAGCTGG + Intergenic
940172103 2:150840324-150840346 AGATAAATGAAACAAAAAGCTGG - Intergenic
940304355 2:152209766-152209788 AGTCTAAATAAAGCAAAATCTGG - Intergenic
940618420 2:156081060-156081082 AGACAAATGAAACAACAAGCTGG - Intergenic
940783312 2:157956296-157956318 AGACTAATCAAACCAAATATTGG + Intronic
940796559 2:158086439-158086461 AGATAAATTAAACAAAAAGCTGG - Intronic
940802522 2:158148474-158148496 AGATAAATGAAACAAAAAGCTGG + Intergenic
941115152 2:161463331-161463353 AATATAATTAAACCAAATGCTGG - Intronic
941679890 2:168386280-168386302 AGATAAATTAAATAAAAAGCTGG + Intergenic
941882055 2:170491010-170491032 CAACTGATGAAACCAAAAGCTGG - Intronic
941913828 2:170794452-170794474 AGAATAAAGAAACCAAAAACAGG - Intronic
942664441 2:178302109-178302131 GACCTAATTAAAGCAAAAGCTGG - Intronic
942991769 2:182210294-182210316 ACACTAACAACACCAAAAGCTGG - Intronic
943199067 2:184795615-184795637 AGATAAATGAAACAAAAAGCTGG + Intronic
943521339 2:188953884-188953906 AAAACAATGAAACCAAAAGCTGG - Intergenic
943580679 2:189680385-189680407 AGATAAATGAAACAAAAAGCTGG - Intronic
943636575 2:190313713-190313735 AGACCAATTAAATCAAACTCTGG + Intronic
944263390 2:197698028-197698050 AGATAAATGAAACAAAAAGCTGG - Intronic
944392831 2:199236139-199236161 AAACCAACCAAACCAAAAGCTGG - Intergenic
944528624 2:200646012-200646034 AGATAAATGAAACAAAAAGCTGG - Intronic
944602374 2:201316256-201316278 AGATAAATGAAACAAAAAGCTGG + Intronic
944603277 2:201325353-201325375 AGATCAATGAAACAAAAAGCTGG + Intronic
944622029 2:201525662-201525684 AGATCAATGAAACCAAAAGTTGG + Intronic
945075415 2:206033786-206033808 AGATAAATGAAACAAAAAGCTGG + Intronic
945113179 2:206383722-206383744 AAATTAATTAATCCAAAAGAAGG + Intergenic
945131746 2:206581161-206581183 AGATAAATGAAACAAAAAGCTGG - Intronic
945350289 2:208769784-208769806 AAATTAATAAATCCAAAAGCTGG - Intronic
945487534 2:210415104-210415126 AGATTAACAAAACCAAAAGTTGG - Intergenic
945754184 2:213826196-213826218 AGATTAATGAAACAAAAAGTTGG - Intronic
945857776 2:215089150-215089172 AAACTAATTCAACAAAAAGTGGG - Intronic
945861403 2:215126744-215126766 AGATAAATGAAACAAAAAGCTGG - Intronic
946036743 2:216749029-216749051 AGACAAATGAAACAAAAAGCTGG + Intergenic
946150475 2:217763564-217763586 AAAATTATGAAACCAAAAGCTGG + Intergenic
946205034 2:218099135-218099157 AGATAAATGAAACAAAAAGCTGG - Intergenic
946824246 2:223660416-223660438 AGATAAATGAAACAAAAAGCTGG + Intergenic
947035929 2:225854887-225854909 AAGCTAATGAAACAAAAAGCAGG - Intergenic
947060754 2:226162492-226162514 AGACAAGCTAAACCAAAAGAAGG - Intergenic
947449075 2:230189152-230189174 AGATCAATTAAACAAAAAGCTGG - Intronic
948045918 2:234945039-234945061 AGATTAATAAAACCAAGAGTTGG - Intergenic
948531453 2:238609459-238609481 AGATAAATGAAACAAAAAGCTGG + Intergenic
948638245 2:239354535-239354557 AGACTAATTAAATCAAGAAAAGG - Intronic
948929377 2:241122307-241122329 AAATTAATGAAACCCAAAGCAGG + Intronic
1169069869 20:2718724-2718746 AAATCAATGAAACCAAAAGCTGG - Intronic
1169335877 20:4756435-4756457 AGATAAATGAAACAAAAAGCTGG - Intergenic
1169397667 20:5248274-5248296 AGATAAATAAAACAAAAAGCTGG - Intergenic
1170086491 20:12538417-12538439 AGATAAATGAAACAAAAAGCTGG + Intergenic
1170162711 20:13330948-13330970 AAATCCATTAAACCAAAAGCTGG - Intergenic
1170197379 20:13703220-13703242 AAATGAATAAAACCAAAAGCTGG + Intergenic
1170241468 20:14171288-14171310 AGATAAATAAAACAAAAAGCTGG - Intronic
1170489212 20:16854681-16854703 AGATAAATGAAACAAAAAGCAGG - Intergenic
1170636719 20:18112644-18112666 AAATCAATGAAACCAAAAGCTGG - Intergenic
1171066694 20:22023938-22023960 AGATAAATGAAACAAAAAGCTGG - Intergenic
1171165866 20:22970256-22970278 AGATAAATGAAACAAAAAGCTGG + Intergenic
1171375325 20:24689843-24689865 AGACAAATGAAACAAAAAGCTGG - Intergenic
1171378400 20:24712122-24712144 AGATAAATTAAACAAAAAGCAGG - Intergenic
1173771066 20:45658650-45658672 AGATAAATGAAACAAAAAGCTGG - Intronic
1173938706 20:46891688-46891710 AGACCAATTAAACCAGACTCTGG - Intergenic
1174352818 20:49980725-49980747 AGACTAATTAAATCAAGATGTGG + Intergenic
1175069392 20:56319579-56319601 AGATAAATGAAACAAAAAGCTGG + Intergenic
1175519864 20:59594735-59594757 AAATCAATGAAACCAAAAGCTGG - Intronic
1175611879 20:60358414-60358436 AAACTAATTTAACAAAAAGTAGG + Intergenic
1176865120 21:14045616-14045638 AAATCAATGAAACCAAAAGCTGG + Intergenic
1177335887 21:19726537-19726559 CCACTAATTAAAGCAAGAGCTGG + Intergenic
1177622463 21:23613875-23613897 AGAAAAATAAAACCAAAAGCTGG + Intergenic
1177846399 21:26292891-26292913 AGTATAATTAAAATAAAAGCGGG + Intergenic
1177893222 21:26832392-26832414 AGACAAATGAAACAAAGAGCTGG + Intergenic
1177948129 21:27498666-27498688 AGATTAATTAAACTAAATGAAGG - Intergenic
1179083884 21:38199747-38199769 AGATAAATGAAACAAAAAGCTGG - Intronic
1179268613 21:39829325-39829347 AGATAAATGAAACAAAAAGCTGG - Intergenic
1179768465 21:43594063-43594085 AGAGTAATTACACCAAAAGCTGG + Intronic
1180251011 21:46588505-46588527 AGATAAATGAAACAAAAAGCTGG + Intergenic
1180542774 22:16466826-16466848 AGATAAATGAAACTAAAAGCTGG + Intergenic
1180760032 22:18194594-18194616 AAATCAATAAAACCAAAAGCTGG + Intergenic
1180770344 22:18378893-18378915 AAATCAATAAAACCAAAAGCTGG + Intergenic
1180775636 22:18430106-18430128 AAATCAATAAAACCAAAAGCTGG - Intergenic
1180775986 22:18483777-18483799 AAATCAATAAAACCAAAAGCTGG - Intergenic
1180808709 22:18741143-18741165 AAATCAATAAAACCAAAAGCTGG - Intergenic
1180828285 22:18881846-18881868 AAATCAATAAAACCAAAAGCTGG + Intergenic
1181071637 22:20346117-20346139 AAATCAATAAAACCAAAAGCTGG - Intergenic
1181194707 22:21175059-21175081 AAATCAATAAAACCAAAAGCTGG - Intergenic
1181214737 22:21317711-21317733 AAATCAATAAAACCAAAAGCTGG + Intergenic
1181370708 22:22414274-22414296 AGATAAATGAAACAAAAAGCTGG - Intergenic
1184239473 22:43204270-43204292 ATACTATTAAAACCAAAAGAAGG - Intronic
1184639596 22:45863026-45863048 AAATCAATAAAACCAAAAGCTGG + Intergenic
1185043210 22:48516163-48516185 AGACTAATTAAACCAGATGGCGG + Intronic
1185106915 22:48876643-48876665 AGATCAATAGAACCAAAAGCTGG - Intergenic
1185174769 22:49319281-49319303 AAATTAATGAAACCAAAAGTTGG - Intergenic
1185369178 22:50452415-50452437 TGACTATTTAAAACAAAAACAGG + Intronic
1203232176 22_KI270731v1_random:120077-120099 AAATCAATAAAACCAAAAGCTGG + Intergenic
1203278381 22_KI270734v1_random:107851-107873 AAATCAATAAAACCAAAAGCTGG + Intergenic
949101724 3:153842-153864 AGATTAATTAAACTCATAGCTGG + Intergenic
949145664 3:697039-697061 AGATAAATGAAACAAAAAGCTGG - Intergenic
949378244 3:3414100-3414122 AGATAAATGAAACAAAAAGCTGG + Intergenic
949799413 3:7887083-7887105 AGATAAATGAAACAAAAAGCTGG + Intergenic
949921161 3:9002633-9002655 AAAATCATGAAACCAAAAGCTGG + Intronic
950960658 3:17102802-17102824 AGATCAATGAAACAAAAAGCTGG + Intergenic
951184060 3:19691542-19691564 AGATAAATTAAACAAAAAGCTGG + Intergenic
951222324 3:20081684-20081706 AGACTATTTAAAGTAAAAGCAGG + Intronic
951268208 3:20594863-20594885 AGATAAATGAAACCTAAAGCTGG - Intergenic
951294738 3:20920307-20920329 AGATAAATGAAACCAAAAGGTGG + Intergenic
951438928 3:22699619-22699641 AAATCAATAAAACCAAAAGCTGG + Intergenic
951493489 3:23299231-23299253 AGATTAATGAAACCAGGAGCTGG - Intronic
951750024 3:26024746-26024768 AGATAAATAAAACAAAAAGCTGG - Intergenic
951763975 3:26176416-26176438 AGATAAATGAAACAAAAAGCTGG - Intergenic
951767102 3:26212208-26212230 AGATCAATGAAACCAAAAGTTGG - Intergenic
951879827 3:27469445-27469467 ACATTAATTAAACCCAAAGAGGG - Intronic
952024197 3:29058539-29058561 AGATAAATGAAACAAAAAGCTGG + Intergenic
952195418 3:31070329-31070351 AGACTAATGAAACCAAAAGTTGG - Intergenic
952227024 3:31387946-31387968 AACCTAATTAATCCAAAAGAAGG - Intergenic
952340937 3:32446436-32446458 AAATCAATGAAACCAAAAGCTGG - Intronic
952463003 3:33549183-33549205 AAACCAGTGAAACCAAAAGCTGG - Intronic
952667472 3:35923749-35923771 ATATTAATTAAACCAAAAGCTGG - Intergenic
953276995 3:41511332-41511354 AGAGAAATGAAACAAAAAGCTGG + Intronic
953382484 3:42483440-42483462 AGATAAATGAAACAAAAAGCTGG + Intergenic
953495464 3:43382595-43382617 AGATAAATGAAACGAAAAGCTGG + Intronic
953560818 3:43991436-43991458 AAATCAATGAAACCAAAAGCTGG + Intergenic
953721641 3:45361054-45361076 AGATCAATGAAACCAAAAGTTGG - Intergenic
953866745 3:46590092-46590114 AGATAAATGAAACAAAAAGCTGG + Intronic
954053013 3:47997645-47997667 AAATTAATGAAACCAAAAGCTGG + Intronic
954964072 3:54595412-54595434 AGACTAATCAAGTGAAAAGCTGG + Intronic
955110011 3:55939640-55939662 AGACTAATTTGACTAAAAGAGGG - Intronic
955175376 3:56608569-56608591 CGACAAATGAAACAAAAAGCTGG - Intronic
955477277 3:59350735-59350757 AGATAAATGAAACAAAAAGCTGG - Intergenic
956466931 3:69528660-69528682 AGACTAAGAAAACCATAGGCTGG - Intronic
956950521 3:74276826-74276848 AGATTAATGAAACAAAAATCTGG + Intronic
957324796 3:78678368-78678390 AAATTAATGAAACCAAGAGCTGG + Intronic
957550425 3:81697151-81697173 AAACTAATTGAACCCAAAGAGGG - Intronic
957916094 3:86689940-86689962 AGATTAATGAAACAAAAAGTTGG + Intergenic
957971955 3:87393453-87393475 AGATAAATGAAACAAAAAGCTGG + Intergenic
958064084 3:88520371-88520393 AAATCAATGAAACCAAAAGCTGG - Intergenic
958505873 3:94976340-94976362 AGATAAATGAAACAAAAAGCTGG + Intergenic
958757454 3:98267575-98267597 AGACTAATGAAACAAAAAGTTGG - Intergenic
958775375 3:98476660-98476682 AGATAAATGAAACAAAAAGCTGG - Intergenic
959039788 3:101407974-101407996 AGATAAATGAAACAAAAAGCTGG + Intronic
959042160 3:101434467-101434489 AGATTAATGAAACAAAAAGTTGG + Intronic
959325448 3:104931036-104931058 AGATAAATGAAACAAAAAGCGGG - Intergenic
959328464 3:104970197-104970219 AGATTAATGAAACAAAAAGTTGG - Intergenic
959374267 3:105568689-105568711 GGTCTAAGTAGACCAAAAGCTGG - Intronic
959436439 3:106320389-106320411 AGAGAAATGAAACAAAAAGCTGG + Intergenic
959730951 3:109601657-109601679 AGATAAATGAAACAAAAAGCTGG - Intergenic
959757161 3:109912433-109912455 AGATAAATGAAACGAAAAGCTGG - Intergenic
959825317 3:110787759-110787781 AGATTAATGAAACCAAAATTTGG - Intergenic
959998338 3:112702929-112702951 AGATAAATGAAACAAAAAGCTGG + Intergenic
960215627 3:115033057-115033079 AAACCAATAAAACCAAAAGTTGG + Intronic
960240165 3:115331493-115331515 AAATTAATTAAACCCAAAGTGGG + Intergenic
960516804 3:118611012-118611034 AGAGAAATGAAACAAAAAGCTGG + Intergenic
960524702 3:118696083-118696105 AGATAAATGAAACAAAAAGCTGG + Intergenic
960769945 3:121182691-121182713 AGATAAATGAAACAAAAAGCTGG + Intronic
960870246 3:122241227-122241249 AGATCAATTAAATGAAAAGCGGG + Intronic
961113642 3:124308856-124308878 AATTTAATGAAACCAAAAGCTGG + Intronic
961264465 3:125630384-125630406 AGATAAATGAAACAAAAAGCTGG - Intergenic
961835424 3:129654282-129654304 AAAATAATTAAAACATAAGCAGG + Intronic
961853315 3:129843423-129843445 AAACCAATGAAAGCAAAAGCTGG + Intronic
962334855 3:134518904-134518926 AGACTAATTAAGAAAAAAGGGGG + Intronic
962503112 3:136015762-136015784 AGAGAAATGAAACAAAAAGCTGG - Intronic
962513286 3:136124697-136124719 TAATTAATTAAACCAAAACCTGG + Intronic
962639350 3:137368104-137368126 AAATTAATAAAACCAAAAACAGG - Intergenic
962764902 3:138552872-138552894 AGATAAATGAAACAAAAAGCTGG + Intronic
962983762 3:140515308-140515330 AGACTAATTAAACCAAAAGCTGG - Intronic
962999643 3:140666917-140666939 AGATAAATAAAACAAAAAGCTGG + Intergenic
963014308 3:140806721-140806743 AGATAAATTTAACAAAAAGCTGG - Intergenic
963176353 3:142301740-142301762 AGATAAATGAAACAAAAAGCTGG + Intergenic
963522268 3:146370230-146370252 AGACAAATGAAACAAAAAGCTGG - Intergenic
963832782 3:150026123-150026145 AGATAAATGAAACAAAAAGCTGG + Intronic
963966347 3:151375177-151375199 AGACTAATTAAGTCAAACTCAGG - Intronic
964147004 3:153475911-153475933 AGACAAATGAAACAAAAGGCTGG - Intergenic
964160910 3:153643826-153643848 AGATAAATGAAACAAAAAGCTGG + Intergenic
964644101 3:158939649-158939671 AGATAAATAAAACAAAAAGCTGG + Intergenic
965033427 3:163403323-163403345 AAAATAATAAAACCGAAAGCTGG - Intergenic
965052471 3:163668595-163668617 AGACAAATGAAACAAAAAGCTGG - Intergenic
965206971 3:165732374-165732396 AAAATAAATAAAGCAAAAGCTGG - Intergenic
965216607 3:165872109-165872131 AGATAAATGAAACAAAAAGCTGG - Intergenic
965235410 3:166113035-166113057 ACATAAATTAAACAAAAAGCAGG + Intergenic
965446846 3:168784062-168784084 AAAAAAATTTAACCAAAAGCTGG + Intergenic
966092986 3:176162582-176162604 AGATAAATGAAACAAAAAGCTGG + Intergenic
966122648 3:176539633-176539655 AGATAAATGAAACAAAAAGCTGG + Intergenic
966153288 3:176889605-176889627 AGACAAATGAAACAAAAAGCTGG + Intergenic
966519672 3:180859404-180859426 GGATTAATGAAACAAAAAGCTGG + Intronic
967203556 3:187098064-187098086 AGACAAATCAAACAAAAAGCTGG + Intergenic
967209350 3:187153330-187153352 AGATAAATGAAACAAAAAGCCGG + Intronic
967400031 3:189050129-189050151 AGATAAATGAAACAAAAAGCTGG + Intronic
967444729 3:189553586-189553608 AAATTAATGAAACTAAAAGCTGG + Intergenic
967784623 3:193478318-193478340 AGATAAATTAAACAAAAAGCTGG + Intronic
967958443 3:194898143-194898165 AGATAAATGAAACAAAAAGCTGG - Intergenic
968162293 3:196436501-196436523 GGATTCATAAAACCAAAAGCTGG + Intergenic
968853123 4:3097202-3097224 AAATCAATAAAACCAAAAGCTGG + Intronic
969165398 4:5305647-5305669 AGATAAATGAAACTAAAAGCTGG - Intronic
969727015 4:8925881-8925903 AGATTAATGAAACAAAAAGTTGG + Intergenic
970549038 4:17160871-17160893 AGATAAATGAAACAAAAAGCTGG - Intergenic
970653966 4:18210570-18210592 AGATCAATAAAACCAAAAGTTGG - Intergenic
971182852 4:24346718-24346740 AGATAAATGAAACAAAAAGCTGG - Intergenic
971645596 4:29197540-29197562 AGACTAATTAAAGATAAAGTGGG - Intergenic
972215073 4:36888501-36888523 AGATCAATGAAACCAAAAGCTGG - Intergenic
972226387 4:37017569-37017591 AAACTAAAAAAGCCAAAAGCTGG + Intergenic
972758113 4:42072215-42072237 AAGTCAATTAAACCAAAAGCTGG - Intronic
972806719 4:42536146-42536168 ATATAAATTAAACAAAAAGCTGG + Intronic
973179322 4:47248954-47248976 AGATGAATGAAACGAAAAGCTGG - Intronic
973548730 4:52009436-52009458 AAATCAATAAAACCAAAAGCTGG + Intronic
973675793 4:53261168-53261190 AGATAAATGAAACAAAAAGCTGG - Intronic
974127370 4:57712913-57712935 AGATAAATGAAACAAAAAGCTGG + Intergenic
974339360 4:60594371-60594393 AGTCTAGTTAAACCAGAAGGGGG - Intergenic
974656719 4:64833525-64833547 CGACAAATGAAACAAAAAGCTGG - Intergenic
975204329 4:71627074-71627096 AGATAAATGAAACAAAAAGCTGG + Intergenic
975290660 4:72674532-72674554 AGATCAATGAAACAAAAAGCTGG - Intergenic
975301134 4:72792335-72792357 AGATAAATTAAACAAAAAGGTGG + Intergenic
975943066 4:79671159-79671181 AGATAAATGAAACAAAAAGCTGG + Intergenic
976044948 4:80934830-80934852 AGATAAATGAAACCAAAAGCTGG - Intronic
976211208 4:82672246-82672268 AAATAAATGAAACCAAAAGCTGG + Intronic
976382113 4:84411431-84411453 AAACTGATTAAACCAGCAGCAGG - Intergenic
976460931 4:85311543-85311565 AGATAAATGAAACAAAAAGCTGG - Intergenic
976562538 4:86518561-86518583 AGATAAATGAAACAAAAAGCTGG - Intronic
976666421 4:87598397-87598419 AGATAAATGAAACAAAAAGCTGG - Intergenic
976686057 4:87816625-87816647 AGATAAATGAAACAAAAAGCTGG - Intergenic
977416980 4:96746176-96746198 AGATAAATGAAACAAAAAGCTGG + Intergenic
977747040 4:100561467-100561489 AGATAAATGAAACAAAAAGCTGG + Intronic
977948271 4:102939070-102939092 AGATAAATGAAACTAAAAGCTGG + Intronic
978163469 4:105577874-105577896 AGATCAATGAAACAAAAAGCTGG - Intronic
978199620 4:106010448-106010470 AGATAAATGAAACAAAAAGCTGG - Intergenic
978213474 4:106167567-106167589 AGATCAATGACACCAAAAGCTGG + Intronic
979052912 4:115956623-115956645 AGATTAATGAAACCAAAAGTTGG - Intergenic
979061586 4:116068422-116068444 AGATAAATGAAACAAAAAGCTGG + Intergenic
979202124 4:117991039-117991061 AGATAAATTAAACAAAAACCTGG + Intergenic
979461026 4:120984116-120984138 AGATAAATGAAACAAAAAGCTGG - Intergenic
979498183 4:121408620-121408642 AGATAAATGAAACAAAAAGCTGG - Intergenic
979584598 4:122400944-122400966 AGATAAATGAAACGAAAAGCTGG - Intronic
979791429 4:124786512-124786534 AGGCTACTTAAACCACATGCTGG + Intergenic
979896120 4:126159467-126159489 ATACTTAATAAACCAAAAGTAGG + Intergenic
979979102 4:127232564-127232586 AGACAAACCAAGCCAAAAGCTGG + Intergenic
980087481 4:128406536-128406558 AGATAAATGAAACAAAAAGCTGG - Intergenic
980152945 4:129070705-129070727 AGATAAATAAAACAAAAAGCTGG - Intronic
980672098 4:136023193-136023215 AAAAAAATTAAACAAAAAGCTGG + Intergenic
980740332 4:136941832-136941854 AGATAAATGAAACAAAAAGCTGG + Intergenic
980761156 4:137235979-137236001 AGATAAATGAAACAAAAAGCTGG - Intergenic
981014396 4:139958739-139958761 AGACTCATTAAAACAAAATGGGG - Intronic
981177454 4:141698779-141698801 AGATAAATGAAACAAAAAGCTGG - Intronic
981408403 4:144398502-144398524 AAATTAATGAAACCAAAATCTGG + Intergenic
981492506 4:145354700-145354722 AAATTAATGAAACTAAAAGCTGG + Intergenic
981760537 4:148189986-148190008 AGATAAATGAAACAAAAAGCTGG - Intronic
981795643 4:148591976-148591998 ATATAAATGAAACCAAAAGCTGG - Intergenic
981801460 4:148662338-148662360 AAATTAATGAAACCAAAAGCTGG - Intergenic
981825109 4:148931319-148931341 AGATAAATGAAACAAAAAGCTGG + Intergenic
981915562 4:150029406-150029428 AGATTAATAAAACCAAGAGAAGG - Intergenic
981975919 4:150727910-150727932 AGAGTGATTAAACAAAAAGTTGG + Intronic
982075554 4:151733162-151733184 AGATAAATGAAACCAAAAACTGG + Intronic
982451324 4:155555482-155555504 AGATAAATGAAACAAAAAGCTGG + Intergenic
982630899 4:157827775-157827797 AGATAAATGAAACAAAAAGCTGG + Intergenic
982668330 4:158292350-158292372 ACACTAACAAAACCAGAAGCAGG - Intergenic
982670136 4:158311010-158311032 AGATTAATGAAACCAAGAGTTGG - Intergenic
982960155 4:161825835-161825857 AGATAAATGAAACAAAAAGCTGG - Intronic
982987152 4:162224176-162224198 AGAGTTATTAAACCAAAAAATGG - Intergenic
983074844 4:163313556-163313578 AGACTAACAACACCAAATGCTGG - Intergenic
983346234 4:166528110-166528132 AAATTAATAAAACCAAAAGTTGG + Intergenic
983477401 4:168230888-168230910 AGATAAATGAAACTAAAAGCTGG + Intronic
983547988 4:168983109-168983131 AGATTAACAAAACCAAAAGTTGG + Intronic
983569550 4:169190265-169190287 AGATAAATGAAACAAAAAGCTGG + Intronic
983894305 4:173065404-173065426 AGATAAATTAAACAAAAAGCTGG - Intergenic
984020528 4:174479420-174479442 AGATAAATGAAACAAAAAGCTGG + Intergenic
984040902 4:174732531-174732553 AGACAAACCAAACCAAAACCTGG + Intronic
984276406 4:177616519-177616541 AGACAAAATAAAACAAAAACAGG + Intergenic
984630317 4:182053702-182053724 ATACAAAATAAATCAAAAGCAGG - Intergenic
985515363 5:341460-341482 AAAGTGATTAAACCAAAAGTTGG - Intronic
986259260 5:6129014-6129036 AGATAAATGAAACAAAAAGCTGG + Intergenic
986475656 5:8128684-8128706 AGATAAATGAAACAAAAAGCTGG - Intergenic
986617624 5:9635884-9635906 AGATAAATGAAACAAAAAGCTGG - Intronic
986629769 5:9759899-9759921 AAACAAATAAAACCAAAAGCTGG + Intergenic
986935531 5:12880729-12880751 AGAATAATAAAACCAAAAGTTGG - Intergenic
987030159 5:13969265-13969287 AGATAAATGAAACAAAAAGCTGG - Intergenic
987248421 5:16074441-16074463 AGATAAATGAAACAAAAAGCAGG + Intronic
987440373 5:17948743-17948765 AGATAAATGAAACAAAAAGCTGG - Intergenic
987898515 5:23980443-23980465 AGATAAATGAAACAAAAAGCTGG + Intronic
987900830 5:24009701-24009723 AGATTAATAAAACCAAAAGTTGG + Intronic
988187141 5:27880446-27880468 AAACCAAGAAAACCAAAAGCTGG - Intergenic
988637551 5:33002626-33002648 ATATCAATGAAACCAAAAGCTGG - Intergenic
988653900 5:33185763-33185785 AAAATAATGAAACCAAAAGCTGG - Intergenic
988889808 5:35602721-35602743 AGACAAATGAAACAAAAAGCTGG + Intergenic
988902495 5:35748372-35748394 AGACAAATGAATCAAAAAGCTGG + Intronic
989299492 5:39872781-39872803 AGAATAAAAAAACCAAAAGTGGG - Intergenic
989355184 5:40536291-40536313 AGATAAATGAAACAAAAAGCTGG - Intergenic
989365862 5:40654237-40654259 AGATTAATGAAACAAAAGGCTGG + Intergenic
989504547 5:42212051-42212073 AGACCAATGAAACAAAAAGTTGG - Intergenic
989525619 5:42450570-42450592 AGACAAGTGAAACAAAAAGCTGG - Intronic
989633716 5:43512633-43512655 AGAATGATTAAACTAAAAACAGG - Intronic
989768136 5:45110516-45110538 TGACTAACTTAAGCAAAAGCAGG - Intergenic
989822418 5:45809691-45809713 AAATCAATAAAACCAAAAGCTGG + Intergenic
990233606 5:53742053-53742075 AGATAAATGAAACAAAAAGCTGG + Intergenic
990472938 5:56133995-56134017 AAATCAATGAAACCAAAAGCTGG + Intronic
990591216 5:57266957-57266979 AGTCTAATTAAACCACAATCTGG - Intergenic
990712568 5:58601792-58601814 AGATAAATGAAACAAAAAGCTGG - Intronic
991623230 5:68568441-68568463 AGACAAATGAAACAAAAAGCTGG + Intergenic
992032618 5:72737508-72737530 AGATTAATGAAACCAAAAGTGGG - Intergenic
992087598 5:73291772-73291794 TGACTGATGAAGCCAAAAGCAGG + Intergenic
992516611 5:77500375-77500397 AAATCAATAAAACCAAAAGCTGG + Intronic
992520594 5:77546313-77546335 AGATAAATCAAACAAAAAGCTGG + Intronic
993233867 5:85277520-85277542 AGATCAATGAAATCAAAAGCTGG + Intergenic
993277577 5:85880351-85880373 AGATAAATGAAACAAAAAGCTGG - Intergenic
993655611 5:90575037-90575059 AGATTAATGAAACCAAAAATTGG - Intronic
994051054 5:95362948-95362970 AGATAAATGAAACAAAAAGCTGG - Intergenic
994358218 5:98819513-98819535 AGATAAATGAAACAAAAAGCTGG + Intergenic
994496808 5:100523090-100523112 AGATAAATGAAACAAAAAGCTGG + Intergenic
994527323 5:100922822-100922844 AGATAAATGAAACAAAAAGCTGG - Intergenic
994659102 5:102632130-102632152 AGATAAATGAAACAAAAAGCTGG + Intergenic
994675987 5:102822748-102822770 AGAGCAATTAAACCAAATGCAGG + Intronic
994872887 5:105376430-105376452 GGATCAATGAAACCAAAAGCTGG - Intergenic
995045092 5:107637009-107637031 AAATTAAATAAACAAAAAGCAGG - Intronic
995317053 5:110787190-110787212 AAACTAATTCAATCAAAACCTGG + Intergenic
995472744 5:112520565-112520587 AGATAAATGAAACAAAAAGCTGG - Intergenic
995587834 5:113667062-113667084 AGACAAATGAAACGAAAAGCTGG + Intergenic
995955589 5:117772645-117772667 AGATAAATAAAACAAAAAGCTGG + Intergenic
995993866 5:118275763-118275785 AAACTAATGAAACAAAGAGCTGG + Intergenic
996141078 5:119910230-119910252 AGACAAATGAAACAAAAAGCTGG - Intergenic
996207985 5:120766271-120766293 AGAATAGATAAAACAAAAGCAGG - Intergenic
996326756 5:122283727-122283749 AGATAAATGAAACAAAAAGCTGG - Intergenic
996448315 5:123585004-123585026 AAACCAATGAAAACAAAAGCTGG - Intronic
996859642 5:128050180-128050202 AGACTACTTTAAACAAAAACAGG - Intergenic
996976010 5:129435542-129435564 AGAATAATTAAAACAAAGTCAGG - Intergenic
997048291 5:130347013-130347035 AGATAAAATAAACCAAAAGTTGG - Intergenic
997290499 5:132729931-132729953 AAATTAATAAAACCAAAAGCTGG + Intronic
997703744 5:135927249-135927271 AAATTAATTAAACCAAAGGCTGG + Intronic
997761183 5:136449239-136449261 AGATAAATGAAACAAAAAGCTGG + Intergenic
997798054 5:136831049-136831071 AGATAAATGAAACAAAAAGCTGG - Intergenic
998028148 5:138838511-138838533 AAATTAATGAAACCCAAAGCTGG - Intronic
998746295 5:145263527-145263549 AGATAAATGAAACAAAAAGCTGG + Intergenic
998961669 5:147494419-147494441 AAATCAATAAAACCAAAAGCTGG + Intronic
999067391 5:148704072-148704094 AGAATAATGAAACAAAAAGTTGG - Intergenic
999213540 5:149912310-149912332 TGACTAATCAAACCAAAGGAAGG - Intronic
999337768 5:150737813-150737835 AGATAAATGAAACGAAAAGCTGG + Intronic
999391163 5:151192231-151192253 AAATCAATGAAACCAAAAGCTGG + Intronic
999490890 5:152050326-152050348 AGATAAATGAAACAAAAAGCTGG - Intergenic
999801013 5:155036319-155036341 AGATAAATGAAACAAAAAGCTGG - Intergenic
999819011 5:155206056-155206078 AGATAAATGAAACAAAAAGCTGG + Intergenic
999822782 5:155245079-155245101 AGATAAATGAAACAAAAAGCTGG - Intergenic
1000602743 5:163294861-163294883 AGACAAATTCAACCAAAAGAAGG + Intergenic
1001189313 5:169612962-169612984 AGATAAATGAAACAAAAAGCTGG - Intergenic
1001230722 5:169985204-169985226 ACACAAATTAAAGCAAAATCTGG - Intronic
1001418516 5:171567255-171567277 AATCAAATGAAACCAAAAGCTGG - Intergenic
1001478679 5:172070658-172070680 AAATCAATGAAACCAAAAGCTGG + Intronic
1001733506 5:173978760-173978782 AGATAAATGAAACAAAAAGCTGG - Intronic
1002162408 5:177323069-177323091 AAATTAATGAAACCAAAAGTTGG + Intergenic
1002511218 5:179719264-179719286 AGACTCATAAAAACAAATGCTGG - Intronic
1002814139 6:662857-662879 AGATAAATGAAACAAAAAGCTGG + Intronic
1002856436 6:1042083-1042105 AGATAAATGAAACAAAAAGCTGG - Intergenic
1003074847 6:2973972-2973994 AGACTAATTAAGCCACAACTAGG - Intergenic
1003451147 6:6233146-6233168 AGATAAATGAAACAAAAAGCTGG + Intronic
1003465213 6:6373290-6373312 AGATAAATAAAACCAAAAGCTGG + Intergenic
1003582288 6:7350954-7350976 AGATAAATGAAACAAAAAGCTGG + Intronic
1003930103 6:10916268-10916290 AGATAAATGAAACAAAAAGCTGG - Intronic
1004033495 6:11897551-11897573 AGACTAATTAAAAAAAAAAGAGG - Intergenic
1004537917 6:16520605-16520627 AGATTAATTAGACTAAAAGAAGG - Intronic
1004766124 6:18729441-18729463 AGACTAACAAAACCAGAAGTTGG + Intergenic
1005038909 6:21583982-21584004 AGATAAATGAAACAAAAAGCGGG - Intergenic
1005072767 6:21877390-21877412 AGATAAATAAAACAAAAAGCTGG + Intergenic
1005468651 6:26140489-26140511 AGTCAAGTTGAACCAAAAGCAGG - Intergenic
1005929617 6:30474118-30474140 AGATAAATGAAACAAAAAGCTGG + Intergenic
1007891171 6:45293534-45293556 AGATAAATGAAACAAAAAGCTGG + Intronic
1008042028 6:46812419-46812441 AGACAAATGAAACAAAAATCTGG - Intronic
1008305579 6:49895098-49895120 AGATAAATGAAACAAAAAGCTGG + Intergenic
1008528354 6:52431144-52431166 AGATAAATGAAACAAAAAGCTGG - Intronic
1008586828 6:52958265-52958287 AAATTAATTAAACCCAAAGAGGG - Intergenic
1008775144 6:55029314-55029336 AGATAAATGAAACAAAAAGCTGG - Intergenic
1008956122 6:57217785-57217807 AAACTGATGAAACAAAAAGCTGG + Intronic
1008973313 6:57395609-57395631 AGATAAATGAAACAAAAAGCTGG - Intronic
1009023900 6:57974730-57974752 ATACTAATTAGGCTAAAAGCAGG + Intergenic
1009162219 6:60297149-60297171 AGATAAATGAAACAAAAAGCTGG - Intergenic
1009199475 6:60726284-60726306 ATACTAATTAGGCTAAAAGCAGG + Intergenic
1009495149 6:64337173-64337195 AGATAAATGAAACAAAAAGCTGG + Intronic
1009611882 6:65955271-65955293 AGAAAAATGAAACAAAAAGCTGG + Intergenic
1009915776 6:69993898-69993920 AGATCAACAAAACCAAAAGCTGG - Intronic
1009969104 6:70607685-70607707 AGATAAATGAAACAAAAAGCAGG + Intergenic
1009997533 6:70913113-70913135 AGACCAGTGAAACCAGAAGCTGG - Intronic
1010164835 6:72903280-72903302 AGATAAATGAAACAAAAAGCTGG - Intronic
1010181632 6:73093351-73093373 AGATAAATGAAACAAAAAGCTGG - Intronic
1010186725 6:73152938-73152960 ACAGGTATTAAACCAAAAGCTGG - Intronic
1010358334 6:74962739-74962761 AGATAAATGAAACAAAAAGCTGG - Intergenic
1010479618 6:76335321-76335343 AGATAAATGAAACAAAAAGCTGG - Intergenic
1010578999 6:77570637-77570659 AGATTAATGAAACCAAAAGCTGG + Intergenic
1011094991 6:83651196-83651218 AAAATGATGAAACCAAAAGCTGG - Intronic
1011210279 6:84948333-84948355 AGATAAATGAAACAAAAAGCTGG - Intergenic
1011312257 6:85992387-85992409 AGTCCAACTAAACCAAAATCTGG - Intergenic
1011394888 6:86896044-86896066 AGATAAATGAAACAAAAAGCTGG + Intergenic
1011529674 6:88307751-88307773 AAATTAATGAAACCAAAAGCTGG - Intergenic
1011923721 6:92615553-92615575 AGATAAATGAAACAAAAAGCTGG - Intergenic
1012192215 6:96294278-96294300 TGATAAATTAAACAAAAAGCTGG + Intergenic
1012203161 6:96431236-96431258 AGACAAATGAAACAAAAAGCTGG - Intergenic
1012337408 6:98077880-98077902 AGACTCATTAAAATAAAAGAAGG - Intergenic
1012558255 6:100544362-100544384 AAACAAATGAGACCAAAAGCCGG + Intronic
1012620369 6:101337396-101337418 AGATTAATGAGACCAAAAGTTGG - Intergenic
1012717296 6:102691917-102691939 AGATAAATGAAACAAAAAGCTGG - Intergenic
1012731039 6:102881012-102881034 AGAGAAATTAAATCAAAAGAGGG - Intergenic
1012794058 6:103737460-103737482 AGATAAATAAAACAAAAAGCTGG + Intergenic
1012817276 6:104040048-104040070 CGATCAATGAAACCAAAAGCTGG + Intergenic
1013132666 6:107249399-107249421 AGACCATTTTAACCAAAATCAGG + Intronic
1013381691 6:109578468-109578490 AGATAAATGAAACAAAAAGCTGG - Intronic
1013425212 6:110005791-110005813 AGGATAATTAACCAAAAAGCCGG - Intergenic
1013510436 6:110839937-110839959 ATATTAATTAATCCCAAAGCAGG - Intronic
1014129908 6:117818847-117818869 AAATTAATTAAACCAAAAGAAGG - Intergenic
1014285310 6:119490351-119490373 AGATAAATGAAACAAAAAGCTGG + Intergenic
1014481793 6:121948227-121948249 AGAAAAATGAAACAAAAAGCTGG - Intergenic
1014520867 6:122440333-122440355 AAATTGATAAAACCAAAAGCTGG + Intergenic
1014531128 6:122560989-122561011 AGATAAATGAAACAAAAAGCTGG - Intronic
1014699061 6:124660792-124660814 AGACACATTCAACCCAAAGCTGG - Intronic
1014853650 6:126372032-126372054 AGATAAATGAAACAAAAAGCTGG - Intergenic
1015222418 6:130819455-130819477 AGATAAATGAAACAAAAAGCTGG + Intergenic
1015348110 6:132183287-132183309 AGATAAATGAAACAAAAAGCTGG + Intergenic
1015900112 6:138056154-138056176 AGATAAATGAAACGAAAAGCTGG + Intergenic
1016258713 6:142141904-142141926 AAATCAATTAAACCAAAATCTGG + Intergenic
1016909868 6:149187762-149187784 AGACAAATGAAACAAAAAGCTGG - Intergenic
1017078977 6:150649046-150649068 AGACAAATTAAAAAAAAAGCAGG - Intronic
1017376134 6:153770876-153770898 AGACAATTTAAATCACAAGCTGG + Intergenic
1017535046 6:155338282-155338304 AGATAAATGAAACAAAAAGCTGG - Intergenic
1017579442 6:155846774-155846796 AGAATAATGTAACCACAAGCTGG + Intergenic
1017606060 6:156134438-156134460 AAACTAATGAAACCAAATGAAGG + Intergenic
1017612450 6:156203743-156203765 ACATCAATGAAACCAAAAGCTGG + Intergenic
1018009672 6:159658496-159658518 AGATAAATAAAACGAAAAGCTGG + Intergenic
1018353021 6:162982244-162982266 AGATAAATGAAACAAAAAGCTGG - Intronic
1018362252 6:163083376-163083398 GGACAACTTAAAGCAAAAGCAGG - Intronic
1018665899 6:166137863-166137885 AGATTAATGAAATAAAAAGCTGG + Intergenic
1019627313 7:2024044-2024066 AAACCAACAAAACCAAAAGCTGG + Intronic
1020332115 7:7029653-7029675 AGATAAATGAAACAAAAAGCTGG - Intergenic
1020334613 7:7053035-7053057 AAATTAATTAAACCCAAAGAGGG + Intergenic
1020446370 7:8272873-8272895 ATAATAATTAAAAAAAAAGCCGG + Intergenic
1020455606 7:8370787-8370809 AGATAAATGAAACAAAAAGCAGG - Intergenic
1020635171 7:10687744-10687766 AGATAAATGAAACAAAAAGCTGG + Intergenic
1020768070 7:12351164-12351186 AGAATGATTAAACCAAATGAGGG + Intronic
1021124017 7:16829858-16829880 AGATTAATGAAACAAAAAGTAGG + Intronic
1021152793 7:17172533-17172555 AAATTAATAAAATCAAAAGCTGG + Intergenic
1021204564 7:17764583-17764605 AGATAAATGAAACAAAAAGCTGG + Intergenic
1021473827 7:21037642-21037664 AGATAAATGAAACAAAAAGCTGG - Intergenic
1021801747 7:24314272-24314294 ATACTAATGAAAATAAAAGCAGG - Intergenic
1022144018 7:27519138-27519160 AGACTCATAAAATCAAAAGCAGG - Intergenic
1022219290 7:28296478-28296500 AAAATAATTAAACCATAACCTGG - Intergenic
1022883447 7:34616127-34616149 AAATCAATTAAACCAAAAGTTGG + Intergenic
1023657381 7:42438143-42438165 AGATAAATGAAACAAAAAGCTGG - Intergenic
1023748654 7:43348461-43348483 AGATAAATGAAAACAAAAGCTGG - Intronic
1023785401 7:43702800-43702822 AGACCAACGAAACCAAAAGTTGG - Intronic
1024126733 7:46306027-46306049 AGATAAATGAAACAAAAAGCTGG - Intergenic
1024235903 7:47397872-47397894 AGATCAATGAAACAAAAAGCTGG + Intronic
1024304736 7:47919066-47919088 AGATAAATAAAACAAAAAGCTGG + Intronic
1024327760 7:48124479-48124501 AGATAAATGAAACAAAAAGCTGG - Intergenic
1024665307 7:51540913-51540935 AGATAAATGAAACAAAAAGCTGG - Intergenic
1024713850 7:52051419-52051441 AAATCAATTAATCCAAAAGCAGG - Intergenic
1024745092 7:52397191-52397213 AGATAAATAAAACAAAAAGCTGG - Intergenic
1024847560 7:53665522-53665544 AGGCAAATGAAACAAAAAGCTGG - Intergenic
1024875973 7:54023793-54023815 AGATAAATGAAACAAAAAGCTGG - Intergenic
1024946850 7:54816934-54816956 AGATAAATGAAACAAAAAGCTGG - Intergenic
1027357145 7:77368651-77368673 AGACTTAGTAAGCCAAAAGCAGG - Intronic
1027573196 7:79898023-79898045 AGACTAACAGAACAAAAAGCAGG + Intergenic
1027784121 7:82557564-82557586 AGAATCATCAAACCAAAAGTTGG + Intergenic
1027927376 7:84483741-84483763 ATACTAATTAAAAAAAAATCTGG + Intronic
1028182755 7:87745751-87745773 AGATAAATGAAACAAAAAGCTGG - Intronic
1028198050 7:87929949-87929971 AGATTAATGAAACAAAAAGCTGG + Intergenic
1028250704 7:88536729-88536751 AGATAAATGAAACAAAAAGCTGG - Intergenic
1028428969 7:90724371-90724393 AAATCAATAAAACCAAAAGCTGG - Intronic
1028696673 7:93721631-93721653 AAATCAATGAAACCAAAAGCTGG - Intronic
1028789105 7:94833401-94833423 AAATTAATAAAACCAAGAGCTGG - Intergenic
1028995927 7:97100024-97100046 AGATAAATGAAACAAAAAGCTGG + Intergenic
1029335423 7:99895012-99895034 AAACCAATGAAACCAAAAGCTGG - Intronic
1030180353 7:106701201-106701223 AAATCAATGAAACCAAAAGCTGG - Intergenic
1030533703 7:110740267-110740289 AGATAAATGAAACAAAAAGCTGG + Intronic
1030910409 7:115241267-115241289 AGAAAAATTAAAACAAAAGCTGG - Intergenic
1030972570 7:116078377-116078399 AGATAAATGAAACAAAAAGCTGG + Intronic
1031090208 7:117345590-117345612 AGATAAATGAAACAAAAAGCTGG - Intergenic
1031148062 7:118019327-118019349 AGATAAATGAAACAAAAAGCTGG + Intergenic
1031256205 7:119451652-119451674 AGACTAACCAAACCAAGAGTTGG + Intergenic
1031290927 7:119932621-119932643 AGACTAATTAAAAAAAATGAGGG + Intergenic
1031676022 7:124613305-124613327 AGATAAATGAAACAAAAAGCTGG + Intergenic
1031740246 7:125420560-125420582 AGATAAATGAAACAAAAAGCTGG + Intergenic
1031879487 7:127180044-127180066 AGATAAATGAAACAAAAAGCTGG + Intronic
1032425833 7:131821439-131821461 ATACCAATTAGACTAAAAGCAGG - Intergenic
1032605024 7:133340967-133340989 AAATTAATAAAACAAAAAGCTGG - Intronic
1032788695 7:135224310-135224332 AAACCAATGAAACCAAAAGACGG + Intergenic
1032900748 7:136304197-136304219 AAAACAATGAAACCAAAAGCAGG - Intergenic
1033007424 7:137581981-137582003 AGAAGAATAAAACCTAAAGCTGG + Intronic
1033027079 7:137785170-137785192 AGATAGATTAAACAAAAAGCTGG + Intronic
1033259926 7:139834513-139834535 AGATAAATTAAACAAAAAACTGG + Intronic
1033623200 7:143081099-143081121 AGATAAATGAAACAAAAAGCTGG + Intergenic
1033714158 7:143982096-143982118 AAACTGATAAAACCAAAAGTGGG - Intergenic
1033816436 7:145079560-145079582 AGACAAATAAAACAAAAATCTGG - Intergenic
1034583632 7:152068736-152068758 AAATTAACAAAACCAAAAGCTGG - Intronic
1034770785 7:153773898-153773920 AAATCAATTAAACCGAAAGCTGG + Intergenic
1035630724 8:1104800-1104822 AGGGTAATTAACCCAACAGCAGG - Intergenic
1036480626 8:9135954-9135976 AGACGTATTCAAACAAAAGCAGG - Intergenic
1036828381 8:11998734-11998756 AGATTAATGAAACCAAAAGTTGG + Intergenic
1037155862 8:15697227-15697249 AGATAAATGAAACAAAAAGCTGG - Intronic
1037369482 8:18159580-18159602 AAAGCAATGAAACCAAAAGCTGG + Intergenic
1038237336 8:25772229-25772251 AGATAAATGAAACAAAAAGCTGG + Intergenic
1038848924 8:31255315-31255337 AGATTAATTGAACCCAAAGAAGG - Intergenic
1038989949 8:32857273-32857295 AGTCTATTTAAACCATATGCAGG + Intergenic
1039420877 8:37438294-37438316 AGATTAATGAAACAAAAAGTTGG - Intergenic
1039540693 8:38365761-38365783 AAACTAATGAAACCAAAACCAGG + Intronic
1039662830 8:39485642-39485664 GGACAAATTAAACCAAGAGGTGG - Intergenic
1039748228 8:40452183-40452205 AGACAAATGCAACAAAAAGCTGG - Intergenic
1039763628 8:40605125-40605147 AGATAAATGAAACAAAAAGCTGG - Intronic
1039811386 8:41052173-41052195 AGATAAATGAAACAAAAAGCTGG + Intergenic
1039889786 8:41677294-41677316 AACTTAATGAAACCAAAAGCTGG - Intronic
1040446224 8:47497157-47497179 AAACCAATGAAACCAAAAGATGG - Intronic
1040465045 8:47686917-47686939 ACCCTAACTAAACCAAAAGCAGG - Intronic
1040635414 8:49267752-49267774 AGATAAATGAAACAAAAAGCTGG - Intergenic
1040812033 8:51464412-51464434 AGATCAATGAAACCAAAAGTTGG + Intronic
1040867760 8:52067518-52067540 AGATAAATGAAACAAAAAGCTGG - Intergenic
1041637385 8:60159277-60159299 AGACAAATGAAACAAAAAGCTGG + Intergenic
1042088871 8:65136647-65136669 AGATAAATGAAACAAAAAGCTGG + Intergenic
1042133415 8:65611372-65611394 AAACCAATGAAATCAAAAGCTGG - Intronic
1042284542 8:67093761-67093783 AGCCAAATTAAACCAAACACAGG + Intronic
1042465425 8:69124395-69124417 AGATGAATAAAACAAAAAGCTGG - Intergenic
1042644667 8:70973408-70973430 AGATAAATGAAACAAAAAGCTGG - Intergenic
1043568555 8:81574896-81574918 AGATAAATGAAACAAAAAGCTGG - Intergenic
1043612287 8:82079944-82079966 ATATCAATGAAACCAAAAGCTGG - Intergenic
1043730421 8:83671794-83671816 AGACTAATTAAACCTTACACTGG + Intergenic
1043790539 8:84462094-84462116 AAACTGATTACACCAAAAGGTGG - Intronic
1043816617 8:84809929-84809951 AGATAAATGAAACAAAAAGCTGG - Intronic
1043819652 8:84846896-84846918 AGATCAATAAAACCAAAAGTTGG - Intronic
1044156294 8:88851800-88851822 AGACTAATAAAACCAAGTGTGGG + Intergenic
1044615925 8:94140622-94140644 AAATCAATGAAACCAAAAGCTGG + Intronic
1044657087 8:94559820-94559842 AGATAAATGAAACAAAAAGCTGG - Intergenic
1044664917 8:94624920-94624942 ATACCTATTAAACCAAAATCTGG - Intergenic
1044907497 8:97020418-97020440 AGATAAATGAAACAAAAAGCTGG + Intronic
1045090888 8:98741777-98741799 AGACTAATGAATCCAGGAGCTGG + Intronic
1045095113 8:98789448-98789470 AGATAAATGAAACAAAAAGCTGG + Intronic
1045121953 8:99047475-99047497 AGATAAATGAAACAAAAAGCTGG - Intronic
1045634608 8:104169625-104169647 AGATAAATAAAACAAAAAGCTGG - Intronic
1046369320 8:113280604-113280626 AGATAAATGAAACAAAAAGCTGG - Intronic
1046515643 8:115256192-115256214 AGACAAATTAAATTCAAAGCAGG - Intergenic
1046574212 8:116005555-116005577 AAATCAATGAAACCAAAAGCTGG + Intergenic
1046664425 8:116984462-116984484 ATAATAACTATACCAAAAGCTGG - Intronic
1047227078 8:122965096-122965118 AGATAAATGAAACAAAAAGCTGG - Intronic
1047332230 8:123901447-123901469 AGATAAATGAAACAAAAAGCTGG - Intronic
1047530850 8:125673800-125673822 AGATAAATGAAACAAAAAGCTGG - Intergenic
1047890197 8:129300182-129300204 AGATAAATGAAACAAAAAGCTGG - Intergenic
1048100291 8:131343464-131343486 ATACCAATTAAGCTAAAAGCAGG - Intergenic
1048371429 8:133780997-133781019 AGAGAAATAAAACAAAAAGCTGG - Intergenic
1048859097 8:138710526-138710548 AAACTACTTAAACCAGGAGCTGG - Intronic
1048994336 8:139783228-139783250 AAATCAATGAAACCAAAAGCTGG + Intronic
1049102868 8:140591461-140591483 TTACTCATTAAACCAAAAGAGGG - Intronic
1049589632 8:143451291-143451313 ACACTAGCAAAACCAAAAGCTGG + Intronic
1049869470 8:144962600-144962622 AGATAAATGAAACAAAAAGCTGG - Intergenic
1049897824 9:126651-126673 AGATAAATGAAACAAAAAGCTGG - Intronic
1050147651 9:2586405-2586427 AGATAAATGAAACAAAAAGCTGG + Intergenic
1050148416 9:2594211-2594233 AGACTAACTCAATCAAAAGCAGG + Intergenic
1050204098 9:3179521-3179543 AGAATAATTAAAGCCAAGGCAGG - Intergenic
1050503073 9:6318669-6318691 AGATAAATGAAACAAAAAGCTGG + Intergenic
1050972634 9:11896086-11896108 AGATCAATAAAACCAAAAGTTGG - Intergenic
1051066585 9:13111386-13111408 AGACTATTTAAACTAAAATGTGG + Intronic
1051362956 9:16297643-16297665 AGATAAATGAAACAAAAAGCTGG + Intergenic
1051521125 9:17990035-17990057 AGACTTGTTAAATGAAAAGCAGG + Intergenic
1052247228 9:26350489-26350511 AGATAAATGAAACAAAAAGCTGG + Intergenic
1052253813 9:26429889-26429911 AGATAAATGAAACAAAAAGCTGG + Intergenic
1052402748 9:28020984-28021006 AAAGAAATGAAACCAAAAGCTGG - Intronic
1052481472 9:29032941-29032963 AGCCTAATTAAACCAATATGAGG + Intergenic
1052537401 9:29764345-29764367 AGACAAATGAAACAAAAAGCTGG + Intergenic
1052624648 9:30959635-30959657 AGATAAATGAAACAAAAAGCTGG - Intergenic
1052662284 9:31449454-31449476 ATAATAATTAAAACAATAGCTGG - Intergenic
1053740916 9:41136945-41136967 AGATAAATGAAACAAAAAGCTGG - Intronic
1054443903 9:65293087-65293109 AGATAAATGAAACGAAAAGCTGG - Intergenic
1054486370 9:65728419-65728441 AGATAAATGAAACGAAAAGCTGG + Intronic
1054687435 9:68294352-68294374 AGATAAATGAAACAAAAAGCTGG + Intronic
1054936841 9:70697149-70697171 TGACAAATTAAAACTAAAGCTGG + Intronic
1055125074 9:72709809-72709831 AGATAAATTGAACAAAAAGCTGG - Intronic
1055156566 9:73069753-73069775 AGACAAACAAAACAAAAAGCTGG + Intronic
1055186897 9:73467925-73467947 AGATAAATGAAACAAAAAGCTGG - Intergenic
1055817817 9:80228321-80228343 AGACTAATTAAATAAAAAGAAGG - Intergenic
1055850226 9:80618849-80618871 AGATAAATTAAAGCAAAAGAGGG + Intergenic
1055886198 9:81066012-81066034 AAATTAATGAAACCAAAAGTTGG - Intergenic
1056026921 9:82507822-82507844 AGATAAATGAAACAAAAAGCTGG + Intergenic
1056146403 9:83734724-83734746 AGATTAACAAAACCAAAAGTTGG - Intergenic
1056242764 9:84665889-84665911 AAATTAATTAAATCAAGAGCTGG - Intergenic
1056309688 9:85327216-85327238 AGATTAATGAAACAAAAAGCTGG + Intergenic
1056396971 9:86190575-86190597 AGATAAATGAAACAAAAAGCTGG + Intergenic
1056696447 9:88859059-88859081 AGATTAATGAAACAAAAAACTGG + Intergenic
1056948372 9:91020829-91020851 AGATAAATGAAACAAAAAGCTGG + Intergenic
1057004088 9:91540741-91540763 AGATAAATGAAACCAAAAGCTGG + Intergenic
1057080249 9:92169129-92169151 AAACTAACTAAACCCAAAGCTGG + Intergenic
1057136831 9:92696369-92696391 AGATCAATGAAACCAAAAGTTGG - Intergenic
1057753989 9:97815803-97815825 AAATCAATGAAACCAAAAGCTGG - Intergenic
1057816686 9:98301131-98301153 AAATTAATTCAACCCAAAGCAGG + Intronic
1058179913 9:101784749-101784771 AGACTCAAAAAAACAAAAGCAGG - Intergenic
1058308143 9:103468666-103468688 AGACAAATGAAACAAAAAGCTGG - Intergenic
1058410728 9:104728144-104728166 AGATAAATTAAACAAAAACCTGG + Intergenic
1058515474 9:105768849-105768871 AAACCAATGAAACCAAAAGCTGG - Intronic
1058540434 9:106006578-106006600 AGACAAATGAAACAAAAATCTGG - Intergenic
1058770973 9:108231400-108231422 AGATAAATCAAACAAAAAGCTGG + Intergenic
1059032938 9:110720285-110720307 AGATAAATGAAACAAAAAGCTGG + Intronic
1059210617 9:112511709-112511731 AAATAAATAAAACCAAAAGCTGG + Intronic
1061380089 9:130250694-130250716 AAATTGATGAAACCAAAAGCTGG - Intergenic
1061997989 9:134197666-134197688 AAACAAATTAAACTTAAAGCAGG + Intergenic
1062642604 9:137528189-137528211 AAATGAATGAAACCAAAAGCTGG - Intronic
1062713875 9:137993227-137993249 AGATAAATTGAACAAAAAGCTGG + Intronic
1185967301 X:4621677-4621699 AAACCAATTAAACCAAAAGCTGG - Intergenic
1186120832 X:6359326-6359348 ACACTGATCAAACCAAATGCTGG - Intergenic
1187801763 X:23071484-23071506 AGATCAACTAAACCAAAAGTTGG + Intergenic
1188179889 X:27041388-27041410 AAATCAATGAAACCAAAAGCTGG - Intergenic
1188361832 X:29264860-29264882 AAATTAATGAAACCAAAAGCTGG - Intronic
1188971941 X:36628459-36628481 AGATTAATGCAGCCAAAAGCTGG - Intergenic
1189152133 X:38719750-38719772 ATACCAATTAGGCCAAAAGCAGG - Intergenic
1189218931 X:39353901-39353923 AGATAAATGAAACGAAAAGCTGG - Intergenic
1189413930 X:40797621-40797643 AGATAAATGAAACAAAAAGCTGG + Intergenic
1189569726 X:42283715-42283737 AGAAAAAAGAAACCAAAAGCTGG - Intergenic
1189604068 X:42657436-42657458 AGATAAATGAAACAAAAAGCTGG + Intergenic
1189639062 X:43047971-43047993 CGATAAATGAAACCAAAAGCTGG - Intergenic
1189663003 X:43323487-43323509 AGATAAATGAAACAAAAAGCTGG - Intergenic
1189878885 X:45468420-45468442 AGATAAATGAAACAAAAAGCCGG - Intergenic
1189931983 X:46022293-46022315 AGATAAATGAAACAAAAAGCTGG + Intergenic
1190571847 X:51790702-51790724 AAATCAATGAAACCAAAAGCTGG - Intergenic
1190897014 X:54630203-54630225 AGATAAATGAAACAAAAAGCTGG - Intergenic
1190902274 X:54687976-54687998 AAATCAATAAAACCAAAAGCTGG - Intergenic
1191045569 X:56132708-56132730 AGATAAATGAAACAAAAAGCTGG + Intergenic
1191100523 X:56722082-56722104 AGATAAATGAAACAAAAAGCTGG + Intergenic
1191143686 X:57142054-57142076 AGATCAATTAAACAAAAAGCTGG - Intergenic
1191144081 X:57147504-57147526 AGAAAAATGAAACAAAAAGCTGG - Intergenic
1191768201 X:64724596-64724618 ACATCAATGAAACCAAAAGCTGG - Intergenic
1191804901 X:65124932-65124954 AGATAAATGAAACAAAAAGCTGG - Intergenic
1191813844 X:65221388-65221410 AGATAAATAAAACAAAAAGCTGG + Intergenic
1191913560 X:66177668-66177690 AGATAAATGAAACAAAAAGCTGG - Intronic
1191954423 X:66628382-66628404 AGATAAATAAAACAAAAAGCTGG + Intronic
1192063110 X:67851378-67851400 AGATAAATGAAACCAAAAGTTGG - Intergenic
1192254841 X:69447748-69447770 ATACAAATTAAGCTAAAAGCAGG + Intergenic
1192298305 X:69873442-69873464 AGATAAATGAAACAAAAAGCTGG + Intronic
1192382458 X:70632616-70632638 AAATTAGTAAAACCAAAAGCTGG + Intronic
1192713097 X:73612256-73612278 AGATCTATTAAACAAAAAGCTGG - Intronic
1192820503 X:74639880-74639902 AGATAAATGAAACAAAAAGCTGG + Intergenic
1192833689 X:74776971-74776993 CGACTACTTAAACAACAAGCTGG + Intronic
1192857656 X:75030651-75030673 AGACCAATGAAACCAAAAGGTGG - Intergenic
1192878387 X:75256562-75256584 AGATAAATGAAACAAAAAGCTGG + Intergenic
1192880836 X:75282209-75282231 AGATAAATGAAACAAAAAGCTGG - Intronic
1192881302 X:75286322-75286344 AGATTAAGTAAATCAAAATCAGG - Intronic
1192892507 X:75406393-75406415 AGACCAATGAAACAAAAAGTTGG + Intronic
1192913338 X:75628990-75629012 AGATAAATGAAACAAAAAGCTGG - Intergenic
1192969453 X:76216449-76216471 AGATAAATGAAACAAAAAGCTGG - Intergenic
1192991622 X:76464813-76464835 AGATAAATGAAACAAAAAGCTGG - Intergenic
1193154977 X:78162377-78162399 AGATAAATGAAACAAAAAGCTGG + Intergenic
1193303223 X:79918181-79918203 AGATAAATGAAACAAAAAGCTGG - Intergenic
1193366556 X:80640915-80640937 AGACAAATGAATCAAAAAGCTGG + Intergenic
1193396856 X:80994496-80994518 AGATCAATAAAACAAAAAGCTGG + Intergenic
1193415465 X:81217220-81217242 AGATAAATGAAACAAAAAGCTGG - Intronic
1193423515 X:81313389-81313411 AGATAAATGAAACAAAAAGCTGG - Intergenic
1193433113 X:81436830-81436852 AGATTAACAAAACCAAAAGCTGG - Intergenic
1193439891 X:81527032-81527054 AGACCAATGAAACCAAGAGTGGG - Intergenic
1193469682 X:81884747-81884769 AGACGAATAAAACAAAAAGCTGG - Intergenic
1193471108 X:81905289-81905311 ATACCAATGAAACAAAAAGCTGG - Intergenic
1193501869 X:82286160-82286182 AAATTAATAAAACCAAAAGTTGG - Intergenic
1193540978 X:82772359-82772381 AGATAAATGAAACAAAAAGCTGG - Intergenic
1193747071 X:85295165-85295187 AGATCAATGAAACCAAAAGTTGG - Intronic
1193864010 X:86707035-86707057 AAATCAATGAAACCAAAAGCTGG + Intronic
1193937782 X:87643116-87643138 AGATAAATGAAACAAAAAGCTGG + Intronic
1193950706 X:87794702-87794724 AGATAAATGAAACAAAAAGCTGG - Intergenic
1194092437 X:89595231-89595253 AAACCAATGAAACCAAAAGATGG + Intergenic
1194211023 X:91069132-91069154 AGATCAATGAAACCAAAAGTTGG + Intergenic
1194234855 X:91370947-91370969 AAAATAATAAAATCAAAAGCTGG - Intergenic
1194236194 X:91386591-91386613 AGACCAATGAAACAAAAAGTTGG + Intergenic
1194237502 X:91402315-91402337 AGATAAATGAAACAAAAAGCTGG + Intergenic
1194381349 X:93195337-93195359 AGATAAATGAAACAAAAAGCTGG + Intergenic
1194547420 X:95254941-95254963 AGATAAATGAAACAAAAAGCTGG - Intergenic
1194606353 X:95983759-95983781 AGATAAATGAAACAAAAAGCTGG - Intergenic
1194631957 X:96296233-96296255 AGATAAATGAAACGAAAAGCTGG + Intergenic
1194632782 X:96306621-96306643 AAATCAATGAAACCAAAAGCTGG + Intergenic
1194634016 X:96321869-96321891 AGATAAATGAAACAAAAAGCTGG - Intergenic
1194684915 X:96901405-96901427 AGATTAAAAAAACAAAAAGCTGG - Intronic
1194816048 X:98442829-98442851 AGACAAGTAAAACAAAAAGCTGG + Intergenic
1194831876 X:98632837-98632859 AGACCAATGAAACAAAAAGTTGG + Intergenic
1195076374 X:101330998-101331020 AGATAAATGAAACAAAAAGCTGG + Intergenic
1195136676 X:101914389-101914411 AGACCAATGAAACAAAAAGCTGG + Intronic
1195142408 X:101975638-101975660 AGACCAACAAAACCAAAAGTAGG - Intergenic
1195231715 X:102856521-102856543 AGATAAATGAAACAAAAAGCTGG - Intergenic
1195237366 X:102914386-102914408 AGATAAATGAAACAAAAAGCTGG + Intergenic
1195284152 X:103367116-103367138 AGACTAATTTAATCAAATGTGGG + Intergenic
1195455221 X:105060990-105061012 AGACCAATGAAATGAAAAGCTGG - Intronic
1195855286 X:109325188-109325210 AGATTAATGAAACAAAAAGGTGG - Intergenic
1195919768 X:109971914-109971936 ATATTAATGAAAACAAAAGCTGG - Intergenic
1195984908 X:110618984-110619006 AGATAAATGAAACAAAAAGCTGG - Intergenic
1196024402 X:111025334-111025356 AGATAAATGAAACAAAAAGCTGG + Intronic
1196261749 X:113591011-113591033 AGATGTATTAAACCTAAAGCTGG - Intergenic
1196465103 X:115963822-115963844 AGATCAATGAAACAAAAAGCTGG + Intergenic
1196477812 X:116109270-116109292 AAATAAATTAAACAAAAAGCTGG - Intergenic
1196530947 X:116785746-116785768 AGATAAATGAAACAAAAAGCTGG + Intergenic
1196578847 X:117355483-117355505 AGATCAATAAAACAAAAAGCTGG - Intergenic
1196730114 X:118932519-118932541 AATTTAATGAAACCAAAAGCTGG - Intergenic
1196994380 X:121365385-121365407 AGATAAATGAAACAAAAAGCTGG - Intergenic
1197071560 X:122304604-122304626 AAATCAATGAAACCAAAAGCTGG - Intergenic
1197141762 X:123124929-123124951 AGATTAATAAATCCAACAGCTGG + Intergenic
1197385303 X:125794686-125794708 AGATAAATTAAACAAAAAGCTGG - Intergenic
1197466532 X:126811133-126811155 AGACCAATAAAACAAAAAGCTGG - Intergenic
1197556048 X:127955384-127955406 AAATCAATAAAACCAAAAGCTGG - Intergenic
1197611750 X:128647008-128647030 AGATAAATGAAACAAAAAGCTGG + Intergenic
1197668815 X:129253172-129253194 AGATAAATGAAACCAAAGGCTGG - Intergenic
1197718481 X:129727686-129727708 AGACTCATAAAACCAATTGCTGG - Intergenic
1197859513 X:130955348-130955370 AAATTAATGAAACAAAAAGCTGG - Intergenic
1197953960 X:131926614-131926636 AGATAAATGAAACAAAAAGCTGG + Intergenic
1198298917 X:135314908-135314930 AGACCAATTAAATGAAAAGTTGG - Intronic
1198433682 X:136593088-136593110 AAACTGATGAAACAAAAAGCTGG - Intergenic
1198523609 X:137476581-137476603 ATACTAATAAATCCTAAAGCAGG - Intergenic
1198695174 X:139328547-139328569 AGATTAATGAAACAAAAAGTTGG + Intergenic
1199049021 X:143213342-143213364 AGAAAAATAAAACAAAAAGCTGG - Intergenic
1199485627 X:148344974-148344996 AGATCAATTAATCCAAGAGCTGG + Intergenic
1199644098 X:149888266-149888288 AGAGAAATTCAAACAAAAGCTGG + Intergenic
1199668816 X:150124003-150124025 AGATAAATTAAACAAAAACCTGG + Intergenic
1199926590 X:152473064-152473086 AGATAAATGAAACAAAAAGCTGG + Intergenic
1200317840 X:155152769-155152791 AGATAAATGAAACAAAAAGCTGG - Intergenic
1200415138 Y:2901992-2902014 AGATAAATAAAACAAAAAGCAGG + Intronic
1200416011 Y:2910584-2910606 ATACTAATTAGGCTAAAAGCAGG - Intronic
1200426411 Y:3025538-3025560 AACCTAATGAAACCAAAAGCTGG - Intergenic
1200445073 Y:3251267-3251289 AAACCAATGAAACCAAAAGATGG + Intergenic