ID: 962989000

View in Genome Browser
Species Human (GRCh38)
Location 3:140561854-140561876
Sequence AACACTATGCAGCTTCTCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 186}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962988996_962989000 16 Left 962988996 3:140561815-140561837 CCTTATAGATGAGGAAACTGAGT 0: 1
1: 8
2: 60
3: 247
4: 733
Right 962989000 3:140561854-140561876 AACACTATGCAGCTTCTCAGTGG 0: 1
1: 0
2: 1
3: 23
4: 186
962988995_962989000 20 Left 962988995 3:140561811-140561833 CCTGCCTTATAGATGAGGAAACT 0: 1
1: 9
2: 124
3: 1065
4: 4499
Right 962989000 3:140561854-140561876 AACACTATGCAGCTTCTCAGTGG 0: 1
1: 0
2: 1
3: 23
4: 186
962988993_962989000 25 Left 962988993 3:140561806-140561828 CCTTGCCTGCCTTATAGATGAGG 0: 1
1: 0
2: 3
3: 39
4: 230
Right 962989000 3:140561854-140561876 AACACTATGCAGCTTCTCAGTGG 0: 1
1: 0
2: 1
3: 23
4: 186
962988992_962989000 26 Left 962988992 3:140561805-140561827 CCCTTGCCTGCCTTATAGATGAG 0: 1
1: 0
2: 0
3: 18
4: 197
Right 962989000 3:140561854-140561876 AACACTATGCAGCTTCTCAGTGG 0: 1
1: 0
2: 1
3: 23
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962989000 Original CRISPR AACACTATGCAGCTTCTCAG TGG Intronic
900627146 1:3613579-3613601 AACATTCTCCAGCTTATCAGAGG + Intergenic
901120868 1:6892351-6892373 AACAAGATGTAGCCTCTCAGAGG - Intronic
901697559 1:11020444-11020466 AACACTTTTCTGCTTCTCAAAGG - Exonic
902483003 1:16721537-16721559 CACACTCTGCAGCTACTGAGAGG + Intergenic
902989140 1:20173967-20173989 AAGGCAATGCAGCTTCTAAGTGG - Intronic
904513754 1:31036664-31036686 AACACTAAGCTGCTCCCCAGTGG - Intronic
906000182 1:42418003-42418025 AAAGGAATGCAGCTTCTCAGAGG + Exonic
906667250 1:47630663-47630685 CACACTATGGAGAATCTCAGTGG - Intergenic
907423464 1:54363136-54363158 AACAGTATCCAGCTGTTCAGGGG - Intronic
909093939 1:71263557-71263579 CACATTATACAGCTTCTGAGAGG - Intergenic
910647756 1:89531826-89531848 ATCATAATGCAGTTTCTCAGAGG + Intronic
912067615 1:105764056-105764078 ATCAATATTCAGCTTCACAGTGG - Intergenic
912189249 1:107318412-107318434 AACACTTTACAGCTTCTCTTTGG - Intronic
913375844 1:118151436-118151458 AAAATTATTCTGCTTCTCAGTGG - Intronic
914666871 1:149839999-149840021 CATACCATGCAGCTTCTAAGAGG + Exonic
914668896 1:149853791-149853813 CATACCATGCAGCTTCTAAGAGG - Exonic
916196861 1:162232489-162232511 AACACTCTTCAGCTTCCCTGAGG - Intronic
918839198 1:189513009-189513031 AGAGCTATGCAGATTCTCAGTGG + Intergenic
1062931850 10:1358398-1358420 AACTCTAGGCAGCTTCTCCCAGG + Intronic
1063963628 10:11327749-11327771 AACGCTGGGCAGCTTTTCAGAGG - Intronic
1064612767 10:17120673-17120695 ACCACTCTGCAGCATGTCAGAGG - Intronic
1064935153 10:20671093-20671115 ATCACTGAGCAGCTTCTCACTGG + Intergenic
1065082962 10:22145420-22145442 AAGACTTTGCACCTTCTTAGAGG + Intergenic
1066617333 10:37308512-37308534 AATCCTATGCAGTTTCTGAGAGG - Intronic
1066932502 10:41781671-41781693 AACAAAATGCAGTTTCTCAGAGG - Intergenic
1069793980 10:71040807-71040829 AAACCTGTGCAGCTTCTGAGAGG - Intergenic
1071835256 10:89411722-89411744 AGGACTGTGCAGCTTCTTAGGGG + Intronic
1072710240 10:97711797-97711819 AAAGCTATGTGGCTTCTCAGCGG - Intergenic
1073145789 10:101280765-101280787 AGCACTGTGGAGCATCTCAGAGG - Intergenic
1074613315 10:115041647-115041669 AAGACTCTGCACCTTCTTAGGGG + Intergenic
1075612998 10:123868329-123868351 ACCCCTAGGCAGCTTCTCTGAGG + Intronic
1076636019 10:131882390-131882412 AACACTGTGCAGAGTCGCAGGGG + Intergenic
1079187155 11:18247995-18248017 AGCACCATGAAGCTTCTCACGGG - Exonic
1079189646 11:18266882-18266904 AGCACCATGAAGCTTCTCACGGG + Exonic
1084579151 11:70011737-70011759 AGCACTCTGCAGATTTTCAGGGG - Intergenic
1085548243 11:77341346-77341368 AACACTTTGCAGCTTTTAAGGGG - Intronic
1086734815 11:90292957-90292979 AATTATATGCAGCTTCACAGAGG + Intergenic
1088007384 11:104959239-104959261 AACACTATTCAGCTTTTAAATGG + Intronic
1091573399 12:1711103-1711125 AGGACTATGCACCTTCTTAGGGG - Intronic
1092865691 12:12758866-12758888 AACACTTTACAGCTTCTCTTTGG + Intronic
1093703123 12:22245692-22245714 AGCCCTATGCAGCTTCAGAGTGG + Intronic
1093907084 12:24705758-24705780 AACACTATGCATCTCCTCTCTGG - Intergenic
1094438447 12:30447833-30447855 AACATTAAGGAGATTCTCAGAGG - Intergenic
1098996087 12:77122253-77122275 AGCACTTTGCAGCTTCTCTTTGG + Intergenic
1099483250 12:83195152-83195174 AACAGACTGCAGTTTCTCAGTGG + Intergenic
1102633747 12:114304449-114304471 AACTCCATGCATCTTCACAGTGG + Intergenic
1104410836 12:128556377-128556399 AACACTGTGCAGGTTCTCATGGG - Intronic
1106163232 13:27219098-27219120 AGAACTCTGCAGCTTCTTAGGGG + Intergenic
1107405963 13:40113673-40113695 AAATCTATGCAGCTTATCACTGG + Intergenic
1107607644 13:42077174-42077196 TACACTATCCAGTCTCTCAGGGG - Intronic
1112991642 13:105521076-105521098 AACAATAAGAAGATTCTCAGGGG - Intergenic
1113709123 13:112452546-112452568 AACACCATGCAGCTACACACTGG + Intergenic
1113763013 13:112863261-112863283 CAAACCATGCAGCTTCCCAGCGG + Intronic
1113763107 13:112863802-112863824 CAGGCCATGCAGCTTCTCAGCGG + Intronic
1113763149 13:112864072-112864094 CAGGCCATGCAGCTTCTCAGCGG + Intronic
1113763377 13:112865370-112865392 CAGGCCATGCAGCTTCTCAGCGG + Intronic
1113763384 13:112865424-112865446 CAGGCCATGCAGCTTCTCAGCGG + Intronic
1115842247 14:37485003-37485025 CACACTATGGGGCTTGTCAGGGG - Intronic
1121909371 14:97775345-97775367 AACACTTTACAGCTTCTCTTTGG + Intergenic
1125335916 15:38626119-38626141 AACTTTCTGAAGCTTCTCAGCGG - Intergenic
1129160414 15:73744491-73744513 AAGGGTATGCAGCTTCTCTGTGG + Intronic
1137556433 16:49473251-49473273 TACTCTTTGCAGCTTCTCATGGG - Intergenic
1141224978 16:82106348-82106370 AGCACTTTACAGCTTCTCTGTGG + Intergenic
1141254762 16:82390665-82390687 AGGACTATGCAACATCTCAGCGG - Intergenic
1141262379 16:82465705-82465727 AACCCTATGCAGCTTTTCCCTGG + Intergenic
1142517728 17:443608-443630 GACCCTATGCTGCTTCTCACTGG - Intronic
1144026313 17:11278989-11279011 AACACGAGGCTGCTTCTCTGTGG - Intronic
1146005861 17:29160246-29160268 AATTCTATTCTGCTTCTCAGAGG + Intronic
1146439397 17:32880741-32880763 AACAGGATGCACCTTCTCAGGGG - Intergenic
1146575397 17:33986658-33986680 AACCCTATGCCTCTTCTCTGTGG - Intronic
1148322681 17:46767055-46767077 CACACTAGGCTCCTTCTCAGGGG + Intronic
1149339313 17:55669639-55669661 AAGTCTGTCCAGCTTCTCAGTGG - Intergenic
1149857282 17:60093868-60093890 AAGACAATGCAGATTCTCATTGG + Intergenic
1152774699 17:82193715-82193737 AACATCATGCAGCATGTCAGTGG - Intronic
1153087495 18:1304667-1304689 AACACTAATCACCTCCTCAGAGG + Intergenic
1156496410 18:37528481-37528503 AATACTATGCAGCTACTAAATGG + Intronic
1156802003 18:41126946-41126968 AGCATTATTCAGTTTCTCAGAGG - Intergenic
1157990912 18:52495161-52495183 AACTCCATTCTGCTTCTCAGAGG + Intronic
1158861629 18:61598211-61598233 AACACTACGTAGCTCCCCAGTGG - Intergenic
1159093484 18:63875084-63875106 AACACGTTGGAGCCTCTCAGAGG - Intronic
1161565780 19:5001423-5001445 AACACTACGCAGCTGTGCAGGGG - Intronic
1166969138 19:46551218-46551240 AACTCTATTCTGCTTTTCAGAGG + Intronic
926428180 2:12758909-12758931 AACATTATTCAGCTTCAAAGAGG - Intergenic
926747003 2:16167035-16167057 TACATTATGCACCTTCTCCGAGG - Intergenic
926911664 2:17857396-17857418 AAGACCATGCAGCAGCTCAGTGG + Intergenic
927982732 2:27384745-27384767 AACTCGAGGCAGCTTGTCAGAGG + Exonic
929576380 2:43055327-43055349 GACACTGTGCAACTACTCAGGGG + Intergenic
929946336 2:46375408-46375430 CTCACTATGCAGCTTTGCAGTGG - Intronic
930455787 2:51605880-51605902 AAAACTGTGCAGACTCTCAGTGG - Intergenic
930777021 2:55183083-55183105 ATCACTAGGCAGCTTTACAGTGG - Intronic
932381867 2:71291576-71291598 AGCACAAGGCAGCTTCTCATAGG - Intronic
932651803 2:73566243-73566265 AACACTTTACAGCTTCTCTTTGG + Intronic
933547475 2:83732901-83732923 AACAAAATACATCTTCTCAGGGG - Intergenic
933972696 2:87483211-87483233 AACACTCTCCTACTTCTCAGTGG - Intergenic
934850878 2:97700399-97700421 AACACTCTGCAGCTTTTCACAGG - Intergenic
936321022 2:111467002-111467024 AACACTCTCCTACTTCTCAGTGG + Intergenic
936551503 2:113446230-113446252 AACACGATTCAGCTTTTCAGAGG + Intronic
936872663 2:117151114-117151136 AATACTATGCAGCTTCCAAGTGG - Intergenic
937602270 2:123752982-123753004 AACACTGTGCAGATTCTTGGTGG - Intergenic
940618243 2:156078815-156078837 ACCACTAGGTATCTTCTCAGAGG - Intergenic
940750405 2:157621349-157621371 AACACTTTGCTCCTTCTCAGGGG - Intronic
947305822 2:228745742-228745764 AAGACTAAGAAGCTTCTAAGTGG - Intergenic
948477897 2:238232287-238232309 AACACTTTTCTGCTTCTCAAAGG - Intergenic
1170334328 20:15251243-15251265 AAAACATGGCAGCTTCTCAGTGG - Intronic
1173879863 20:46404137-46404159 CATACCATGCAGCATCTCAGAGG - Intronic
1174748193 20:53085483-53085505 ACCACTATGCAGTTTCTCCTCGG - Intronic
1176135028 20:63518768-63518790 AACACCATGCAGCGTCTCTGAGG + Intergenic
1181402105 22:22656160-22656182 TAGACTATGGAGCTTCTCCGGGG + Intergenic
949363859 3:3259694-3259716 AAGAATGTGCAGATTCTCAGAGG - Intergenic
950674178 3:14544735-14544757 AACAAGATGCAGGTTCTGAGAGG - Intergenic
952035065 3:29190329-29190351 AAAGCTATGCAGCTTCTATGTGG + Intergenic
952984292 3:38763789-38763811 ATCACAATGCATCTTCTCAAAGG - Intronic
955425629 3:58786715-58786737 AACACTTTGAAGCTTCTCTTTGG - Intronic
958653231 3:96965108-96965130 AACACTTAGCAGCCTCTGAGTGG + Intronic
959001742 3:100971927-100971949 ATCAACATGCAGTTTCTCAGTGG + Intronic
959564249 3:107818264-107818286 AAGCCTATTCAGCTTCCCAGTGG + Intergenic
961535510 3:127568262-127568284 CCCACTCTGCAGCCTCTCAGAGG - Intergenic
962921592 3:139955249-139955271 AACATCCTGTAGCTTCTCAGTGG - Intronic
962989000 3:140561854-140561876 AACACTATGCAGCTTCTCAGTGG + Intronic
965978787 3:174660558-174660580 AACAATATGCTGCATCTCTGAGG + Intronic
966022750 3:175236044-175236066 ATCACTGTGCAGCTTCTCCGAGG + Intronic
969386036 4:6849013-6849035 AACACTTCACAGCTGCTCAGGGG - Intronic
970660263 4:18277475-18277497 AACAATATTCAGCTTGTGAGTGG + Intergenic
971174334 4:24266296-24266318 AACACGAAGCAACTCCTCAGCGG - Intergenic
971978931 4:33729223-33729245 AACACTATTCAGAGTCACAGGGG - Intergenic
976174085 4:82334792-82334814 AGGACTCTGCACCTTCTCAGGGG - Intergenic
976967237 4:91058176-91058198 CACACACTGGAGCTTCTCAGAGG - Intronic
977847105 4:101779314-101779336 AACACTTGGCAGACTCTCAGAGG - Intronic
982231717 4:153214322-153214344 AACACTATGCAGGTTATTGGAGG - Intronic
984566545 4:181337648-181337670 AACAGTTTGCAGCTTCTCAAAGG - Intergenic
985028812 4:185767879-185767901 AACTCAATGCACCTTCCCAGGGG + Intronic
987177765 5:15334138-15334160 AACACAATGGATCTTCTCAATGG + Intergenic
987818666 5:22934385-22934407 AAGACTCTGCACCTTCTTAGAGG + Intergenic
987864098 5:23518893-23518915 AACACTAAGGAGGCTCTCAGAGG - Intronic
989543446 5:42644904-42644926 AACACAATTCACATTCTCAGGGG + Intronic
990045591 5:51426655-51426677 AACACTCTCCCACTTCTCAGTGG + Intergenic
990174945 5:53097272-53097294 AACACTCTGCATCTTATCTGTGG - Intronic
991413105 5:66364769-66364791 AACTCTCTGCAGTTTCTCATCGG + Intergenic
991501144 5:67278832-67278854 AAAAGTATGCAGCAGCTCAGTGG + Intergenic
996160236 5:120152862-120152884 AACACTTTACAGCTTCTCTTTGG - Intergenic
996681048 5:126228467-126228489 AAGACTCTGCACCTTCTTAGGGG + Intergenic
996700034 5:126441515-126441537 AAAACTATGCAGGTGCTCAAAGG + Intronic
997701960 5:135908625-135908647 AAAACTATGTACCTTCTCTGGGG - Intergenic
998680174 5:144458271-144458293 TACACTCTGCTTCTTCTCAGTGG - Intronic
998815803 5:146013182-146013204 AACACTAAGCATCTACTCTGGGG + Intronic
999654520 5:153799086-153799108 AAAGCTAGGCAGCTTGTCAGGGG - Intronic
1000538369 5:162507816-162507838 AACACAATGCACCTTCTAACTGG + Intergenic
1001668807 5:173456647-173456669 AATACTATGCAGCTGTTAAGAGG - Intergenic
1002366957 5:178720579-178720601 AATTCTATGCAGAGTCTCAGAGG + Intronic
1005136956 6:22580237-22580259 ACCAATATGCAGCTTCTTGGAGG - Intergenic
1007464973 6:42045476-42045498 AACACCATTCAGCTCCTAAGTGG + Intronic
1007635306 6:43296452-43296474 AACACTTTGCAGCTCCTGAGAGG - Intronic
1009260109 6:61475444-61475466 ATCACAATGCAGTTTCTCAGAGG - Intergenic
1009746108 6:67818264-67818286 TACACTATGCTGCCTCTCAAGGG - Intergenic
1009863488 6:69366559-69366581 AACAGTATGAAGCTACTCAAAGG - Intronic
1011224929 6:85095423-85095445 AAGACTCTGCACCTTCTTAGGGG + Intergenic
1013175544 6:107673537-107673559 AAGACTAGGCAGCTTCACAAAGG - Intergenic
1013977692 6:116095825-116095847 AGGACTTTGCAGCTTCTTAGGGG + Intergenic
1017757346 6:157540516-157540538 AACTCTATGGAGCTTCTCCAAGG - Intronic
1018297590 6:162365913-162365935 TCCATTATGCATCTTCTCAGTGG - Intronic
1019900290 7:4015219-4015241 AACACCACCCAGCTTCTGAGTGG + Intronic
1021556251 7:21921554-21921576 TAGACTATGCAGCTACCCAGTGG - Intronic
1023283317 7:38593682-38593704 AACAGGATGCAGCATTTCAGTGG - Intronic
1023835491 7:44065070-44065092 CCCACTCTGCAGCTTCCCAGAGG + Intronic
1024209046 7:47188152-47188174 AAGACTTTGCAGAGTCTCAGGGG - Intergenic
1024783734 7:52882094-52882116 AACAGGAAGCAGCATCTCAGAGG + Intergenic
1024982943 7:55172838-55172860 GACACTATGTAGCTTCTAAAAGG - Intronic
1026259113 7:68738732-68738754 AACACTATGCTGAACCTCAGGGG + Intergenic
1028016716 7:85724185-85724207 AAAACTTTGTAGCTTCTCTGGGG - Intergenic
1028724146 7:94068457-94068479 GACACTATGCAAATTCTCAGAGG + Intergenic
1029375092 7:100172298-100172320 AACACTTTGCTGCTTCTCTAAGG - Intronic
1029799246 7:102929016-102929038 TAAACTAAGCATCTTCTCAGTGG - Intronic
1034852375 7:154506790-154506812 CACACTAAGCAGCTTCTAAAAGG - Intronic
1034953769 7:155319797-155319819 AACACTATGCAGCCTTACAAAGG - Intergenic
1035353189 7:158261032-158261054 ATCACAGTGCAGCTTCTCAGAGG - Intronic
1036776541 8:11616860-11616882 ACCACAAGGCAGCTTCCCAGGGG - Intergenic
1038168750 8:25109676-25109698 AAAACTAGTAAGCTTCTCAGGGG + Intergenic
1038692608 8:29776431-29776453 AACACTTTGCAGCTTGTAGGTGG + Intergenic
1039781169 8:40787569-40787591 AACACTTTACAGCTTCTCTTTGG + Intronic
1040759608 8:50823231-50823253 ATCTTTATGCAGCTTCTAAGTGG + Intergenic
1042743080 8:72073600-72073622 AACTCTATGTAGCTTCTAAAAGG + Intronic
1043719473 8:83528943-83528965 AGCACTTTGCAGCTTCTCTTTGG - Intergenic
1045388216 8:101690854-101690876 AACACTTTGCAGTCTCTCAGGGG + Intronic
1047189047 8:122661413-122661435 AGGACTAAGCAGCTTCCCAGTGG + Intergenic
1048147187 8:131856783-131856805 AACATTGTGCAGCTTCTCACTGG + Intergenic
1049848920 8:144820447-144820469 GATGCTTTGCAGCTTCTCAGTGG - Intergenic
1049901496 9:170898-170920 AACACGATTCAGCTTTTCAGAGG - Intronic
1050376926 9:4984150-4984172 AAAACTATGCATTTTCTTAGTGG + Intergenic
1050834048 9:10053490-10053512 AAAGCTATGGATCTTCTCAGTGG + Intronic
1052757337 9:32554486-32554508 AAAACTATACAGCTTGTCAGTGG - Intronic
1053354040 9:37431576-37431598 CACACTGTGGTGCTTCTCAGTGG + Intronic
1053744529 9:41181193-41181215 AACACGATTCAGCTTTTCAGAGG - Intronic
1054349797 9:64011083-64011105 AACACGATTCAGCTTTTCAGAGG - Intergenic
1054482741 9:65684020-65684042 AACACGATTCAGCTTTTCAGAGG + Intronic
1054683816 9:68250057-68250079 AACACTATTCAGCTTTTCAGAGG + Intronic
1055281349 9:74678179-74678201 AACGTTAAGCAGCTTCTAAGTGG + Intronic
1056868683 9:90255845-90255867 CACACATTGCAGCTTCTGAGAGG + Intergenic
1059051301 9:110929275-110929297 AACAGAAAGTAGCTTCTCAGAGG + Intronic
1060011782 9:120050085-120050107 CACACTATCCAGCCTCTCATGGG + Intergenic
1186227759 X:7419773-7419795 TACACTATGCACCTTCTAAAAGG - Intergenic
1188249013 X:27868804-27868826 AACACTATGGAGCTGTTCATTGG + Intergenic
1188546686 X:31315053-31315075 AACAGGATGCTGCTTCCCAGGGG + Intronic
1191268563 X:58431039-58431061 ATCACAAAGCAGTTTCTCAGAGG + Intergenic
1191698028 X:64009317-64009339 AACACAATGCAGATGCTCAGTGG + Intergenic
1191788939 X:64947739-64947761 AACACTCAGCAGCGTATCAGTGG - Intronic
1192527468 X:71859985-71860007 AACTTGATACAGCTTCTCAGGGG - Intergenic
1195969658 X:110459301-110459323 AAAACTATCCAGCTTGTTAGAGG - Intergenic
1198720790 X:139617396-139617418 AATACTTTTCATCTTCTCAGAGG - Intronic
1199010366 X:142751063-142751085 AACATTATTCAGCTTTTCAAAGG - Intergenic
1199044928 X:143158705-143158727 AACATTCTACAGCTTCTCAAGGG + Intergenic
1201406806 Y:13658102-13658124 AGGACTCTGCAGCTTCTTAGGGG - Intergenic