ID: 962990473

View in Genome Browser
Species Human (GRCh38)
Location 3:140573064-140573086
Sequence GCTTACAGAAACCTGGCAGG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 165}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962990473_962990479 9 Left 962990473 3:140573064-140573086 CCACCTGCCAGGTTTCTGTAAGC 0: 1
1: 0
2: 1
3: 12
4: 165
Right 962990479 3:140573096-140573118 TCTTCGAGGGCCATATTTTGTGG 0: 1
1: 0
2: 0
3: 11
4: 118
962990473_962990477 -4 Left 962990473 3:140573064-140573086 CCACCTGCCAGGTTTCTGTAAGC 0: 1
1: 0
2: 1
3: 12
4: 165
Right 962990477 3:140573083-140573105 AAGCTGAGCAGCCTCTTCGAGGG 0: 1
1: 0
2: 0
3: 7
4: 99
962990473_962990476 -5 Left 962990473 3:140573064-140573086 CCACCTGCCAGGTTTCTGTAAGC 0: 1
1: 0
2: 1
3: 12
4: 165
Right 962990476 3:140573082-140573104 TAAGCTGAGCAGCCTCTTCGAGG 0: 1
1: 0
2: 0
3: 8
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962990473 Original CRISPR GCTTACAGAAACCTGGCAGG TGG (reversed) Exonic