ID: 962990479

View in Genome Browser
Species Human (GRCh38)
Location 3:140573096-140573118
Sequence TCTTCGAGGGCCATATTTTG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 118}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962990472_962990479 18 Left 962990472 3:140573055-140573077 CCAGGAAGGCCACCTGCCAGGTT 0: 1
1: 0
2: 6
3: 22
4: 226
Right 962990479 3:140573096-140573118 TCTTCGAGGGCCATATTTTGTGG 0: 1
1: 0
2: 0
3: 11
4: 118
962990469_962990479 20 Left 962990469 3:140573053-140573075 CCCCAGGAAGGCCACCTGCCAGG 0: 1
1: 0
2: 2
3: 43
4: 388
Right 962990479 3:140573096-140573118 TCTTCGAGGGCCATATTTTGTGG 0: 1
1: 0
2: 0
3: 11
4: 118
962990471_962990479 19 Left 962990471 3:140573054-140573076 CCCAGGAAGGCCACCTGCCAGGT 0: 1
1: 0
2: 1
3: 11
4: 263
Right 962990479 3:140573096-140573118 TCTTCGAGGGCCATATTTTGTGG 0: 1
1: 0
2: 0
3: 11
4: 118
962990473_962990479 9 Left 962990473 3:140573064-140573086 CCACCTGCCAGGTTTCTGTAAGC 0: 1
1: 0
2: 1
3: 12
4: 165
Right 962990479 3:140573096-140573118 TCTTCGAGGGCCATATTTTGTGG 0: 1
1: 0
2: 0
3: 11
4: 118
962990474_962990479 6 Left 962990474 3:140573067-140573089 CCTGCCAGGTTTCTGTAAGCTGA 0: 1
1: 0
2: 1
3: 19
4: 188
Right 962990479 3:140573096-140573118 TCTTCGAGGGCCATATTTTGTGG 0: 1
1: 0
2: 0
3: 11
4: 118
962990475_962990479 2 Left 962990475 3:140573071-140573093 CCAGGTTTCTGTAAGCTGAGCAG 0: 1
1: 0
2: 1
3: 11
4: 155
Right 962990479 3:140573096-140573118 TCTTCGAGGGCCATATTTTGTGG 0: 1
1: 0
2: 0
3: 11
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962990479 Original CRISPR TCTTCGAGGGCCATATTTTG TGG Exonic