ID: 962990744

View in Genome Browser
Species Human (GRCh38)
Location 3:140574943-140574965
Sequence GGTCATGGATGTTAATATAA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 118}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962990738_962990744 9 Left 962990738 3:140574911-140574933 CCTCTGTGAGGAGGGCCTTGCTT 0: 1
1: 0
2: 1
3: 15
4: 221
Right 962990744 3:140574943-140574965 GGTCATGGATGTTAATATAAAGG 0: 1
1: 0
2: 0
3: 13
4: 118
962990741_962990744 -6 Left 962990741 3:140574926-140574948 CCTTGCTTGTGCCTGTGGGTCAT 0: 1
1: 0
2: 1
3: 18
4: 185
Right 962990744 3:140574943-140574965 GGTCATGGATGTTAATATAAAGG 0: 1
1: 0
2: 0
3: 13
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962990744 Original CRISPR GGTCATGGATGTTAATATAA AGG Exonic
907042722 1:51277867-51277889 GGGCATGGATTTTAATAAACTGG + Intergenic
907177044 1:52534048-52534070 GGTCAGGGATGTTATGATAACGG - Intronic
909796349 1:79741891-79741913 GGTCATTGAGGTGAAAATAATGG + Intergenic
910515053 1:88051585-88051607 TGACCTGCATGTTAATATAATGG - Intergenic
911375621 1:97047169-97047191 AGTTATGGATGTTCATAGAAGGG + Intergenic
920038080 1:203078255-203078277 GGTAATGGATGGTAAGATGATGG + Exonic
920724065 1:208417197-208417219 GGTCGTGGATGTTCATTTAGTGG - Intergenic
1063025096 10:2170342-2170364 GGTGAAGGATGTAAATTTAATGG - Intergenic
1064595558 10:16941368-16941390 TCTCAAGGATGTAAATATAAAGG + Intronic
1067839327 10:49663496-49663518 GGTCACAGATATTATTATAAAGG + Intronic
1069125032 10:64619480-64619502 GGTCAAGGATTTTGAAATAAGGG - Intergenic
1070057947 10:72953657-72953679 GGCCCTGGAAGTTAATGTAAGGG - Intronic
1070780194 10:79133089-79133111 GGTCTTGGATGCTATTCTAAGGG - Intronic
1071125906 10:82334213-82334235 GGTCAGGGATGTGTAAATAAGGG + Intronic
1071807431 10:89139340-89139362 TGTCATGGATGTTAAAATGTTGG - Intergenic
1073656955 10:105426566-105426588 GGAAATGGATGTTAAGAGAATGG - Intergenic
1079898896 11:26156065-26156087 GGTGATGGAAGTTAGTATCAGGG + Intergenic
1080618986 11:33970850-33970872 GGTCTTGGAGGTTGAAATAATGG - Intergenic
1082612627 11:55320132-55320154 GGTCATGGATTTTTTTAAAAAGG - Intergenic
1083482171 11:62956414-62956436 GGTCATGGGTTTTAATAAAAAGG - Intronic
1085993495 11:81881174-81881196 AGTCATGGATATTTTTATAAAGG - Intergenic
1087620632 11:100537635-100537657 AGTCATGAATGTTAATTTGAAGG - Intergenic
1097369164 12:58755272-58755294 GGTCATGGAAGCAAACATAAAGG + Intronic
1097780954 12:63703944-63703966 GGTCAGGGAATTAAATATAAAGG - Intergenic
1104642707 12:130477769-130477791 GGTCTTGGATCTCAAAATAAAGG - Intronic
1104691818 12:130832288-130832310 CCTCATGGCTGTTTATATAATGG - Intronic
1107334533 13:39339947-39339969 GGTCATGGAAATTAGAATAATGG - Intergenic
1107566947 13:41614583-41614605 GGTCATGGAATTTAAAAGAAGGG + Intronic
1109417148 13:62055573-62055595 TGTCATGCATTTTAATATAAGGG - Intergenic
1111466782 13:88623461-88623483 GGTGAGGGTTGTTATTATAAAGG - Intergenic
1113226570 13:108166491-108166513 GGCTGTGGATGTTAATATAATGG + Intergenic
1114809838 14:25885135-25885157 GATCATGGAAGTTACTATAAAGG - Intergenic
1116752652 14:48906017-48906039 GGTCAGGGATGTTGATAACAGGG + Intergenic
1123776773 15:23588430-23588452 GGAGATAGAAGTTAATATAATGG - Intronic
1131815803 15:96219952-96219974 GGTTAAGGATGTTAAGATAAGGG + Intergenic
1135636691 16:24082716-24082738 GGTCATGGAGCAAAATATAAAGG + Intronic
1138935023 16:61709105-61709127 GGGTATGGATGTTTTTATAAAGG + Intronic
1149024331 17:52008491-52008513 GGTTAAGTATGTTAATTTAATGG + Intronic
1151163731 17:72186852-72186874 TTTCATGGATGATAATATAAAGG - Intergenic
1152931630 17:83113128-83113150 GTCCATGGATGTGAATAAAACGG + Intergenic
1155729839 18:29141700-29141722 GGATTTGGATGTTAATATCAGGG + Intergenic
1155817940 18:30338578-30338600 GGTCATAGATATGAAAATAAGGG + Intergenic
1156160193 18:34350492-34350514 TGTGATGAATGTCAATATAATGG - Intergenic
1158643889 18:59226689-59226711 CCTCATTGATCTTAATATAAAGG + Intronic
1159504825 18:69322324-69322346 GTTCATAGAAGTAAATATAATGG + Intergenic
1161387414 19:4003282-4003304 GGGCGTTGATGTTAGTATAATGG - Intergenic
1163741880 19:19019616-19019638 GGTTATGGTTCTCAATATAAAGG + Intronic
1163923420 19:20315123-20315145 GGTGATGGAAGCAAATATAATGG + Intergenic
1163973528 19:20825507-20825529 GATCATGGAAGCAAATATAATGG + Intronic
925034997 2:677966-677988 GGGTATAGATGTTAAAATAAAGG - Intergenic
925197175 2:1935427-1935449 GGTCATGGATGTTAGGTTCAGGG + Intronic
925427627 2:3763417-3763439 GGTCATGGATTTTTCTAAAATGG + Intronic
933841407 2:86289413-86289435 AGTCATGGTTGTTAATATTATGG - Intronic
933950487 2:87325119-87325141 TGTCATCGATTATAATATAATGG - Intergenic
936242921 2:110803757-110803779 AGTCATATATATTAATATAAGGG + Intronic
936329291 2:111533460-111533482 TGTCATCGATTATAATATAATGG + Intergenic
936667452 2:114613263-114613285 GGTTATGGATATTAAGTTAATGG + Intronic
942669781 2:178362758-178362780 TGTCATGGATGTTGTTATATGGG + Intronic
944080613 2:195784026-195784048 GGTCATGGATGTTGATACTGGGG - Intronic
947397965 2:229705255-229705277 GGTCCTTGTAGTTAATATAAAGG - Intronic
948744435 2:240076471-240076493 GCTGAAGGATGTTAATATTAGGG + Intergenic
1178552350 21:33551399-33551421 GGTGTTGGATGCTAATATATGGG - Exonic
1179728187 21:43352399-43352421 TCTCAAGGATGTAAATATAAGGG - Intergenic
949243489 3:1898124-1898146 CGTCCTGGATGGTACTATAAAGG - Intergenic
954873786 3:53787388-53787410 GGTGATGGATGTTACTGAAATGG - Intronic
955137338 3:56232764-56232786 GGTCTTGGATGTAAATACAGTGG - Intronic
956477464 3:69637523-69637545 GGTCAAGGATTATAATATAAAGG - Intergenic
957497045 3:81006307-81006329 GGAAATAGAGGTTAATATAAAGG - Intergenic
957536024 3:81504647-81504669 GGACATGGATTATAAAATAATGG - Intronic
960286723 3:115838261-115838283 GGTGATGGGTGATAATTTAAAGG - Intronic
962990744 3:140574943-140574965 GGTCATGGATGTTAATATAAAGG + Exonic
963705812 3:148687089-148687111 TGATATGGATTTTAATATAAAGG - Intergenic
964783744 3:160371066-160371088 AGTCCTGGATGTTAAAAGAAGGG - Intronic
966367021 3:179200334-179200356 GATCATGGGTGATAATATATAGG + Intronic
967563874 3:190950909-190950931 GGTCATGGAGATGAATAAAATGG - Intergenic
968032809 3:195517005-195517027 TGTCATGCATGCTAATAGAAGGG - Intronic
971039508 4:22735826-22735848 GCTCATGCATGTTATTTTAAAGG + Intergenic
972475875 4:39448872-39448894 GTTCTTGGATGTAAACATAAAGG + Exonic
976838093 4:89398867-89398889 GTTCATGCATATTAATAGAAGGG + Intergenic
978235514 4:106453313-106453335 GGTGATGGATGGTAATACACAGG + Intergenic
979228423 4:118318723-118318745 GGTAATGGCTGAAAATATAAAGG - Intronic
982489997 4:156018052-156018074 GTTCATGTGTGTTAGTATAAAGG + Intergenic
983248775 4:165320809-165320831 GATCATGGATGTGGCTATAAAGG + Intronic
983761285 4:171409435-171409457 GGTCATGGAAGTGCAAATAAGGG - Intergenic
983953822 4:173674244-173674266 GGCCATGGGTGTTGAAATAAAGG + Intergenic
984185832 4:176542542-176542564 GGTTATAAATGTTAATATGAAGG - Intergenic
984485032 4:180357377-180357399 TGCTATGGATGTTTATATAAGGG - Intergenic
987012352 5:13780488-13780510 TTTCAAGGATGTTAATACAATGG - Intronic
987314546 5:16711898-16711920 GAACATGGATATTAATATAAAGG - Intronic
990079329 5:51893223-51893245 GGTCAGGAAGCTTAATATAATGG - Intergenic
991303933 5:65156755-65156777 GGTCAAGGATTTTAAGATGAAGG + Intronic
994540451 5:101089567-101089589 GTTAATGGTTGTTAATAAAAGGG - Intergenic
1000599945 5:163260436-163260458 GGTCATGGATATTATTTTATAGG - Intergenic
1001121756 5:168986569-168986591 GGTCATGCAAGTTATGATAAAGG - Intronic
1009296058 6:61949081-61949103 GGTCCTGGATGTTTATAGCATGG - Intronic
1011710687 6:90050274-90050296 AGTAATGAATTTTAATATAATGG + Intronic
1013036362 6:106387852-106387874 GTTCATGGATGATAATACATAGG - Intergenic
1019126783 6:169846087-169846109 GGTCATGGAATTTATTATAAGGG + Intergenic
1020711287 7:11608743-11608765 GGTTGTGGATGTTCATCTAAGGG - Intronic
1022939536 7:35220002-35220024 GGTCAGGGAATTAAATATAAAGG - Intronic
1029104229 7:98162253-98162275 GGTCATTTATGGTAACATAAAGG - Intronic
1030249378 7:107425409-107425431 GGTCATTAATGTTTATATGATGG - Intronic
1030808213 7:113943231-113943253 GGTCATTAATTTTATTATAAAGG - Intronic
1036460259 8:8946212-8946234 TGTCATGTATGTAAATATCACGG + Intergenic
1038139527 8:24828294-24828316 GGTCATTGATGTTTAATTAAAGG + Intergenic
1041017446 8:53605449-53605471 GTTGAGGGATTTTAATATAAAGG - Intergenic
1041781414 8:61581084-61581106 TGTCAAGGCTGTTAAAATAATGG + Intronic
1042042807 8:64611658-64611680 GGTGAGGGATGTTAAAGTAAAGG - Intronic
1043010799 8:74879583-74879605 GGTCGTGGATGTTTACAGAATGG + Intergenic
1044472816 8:92590537-92590559 GTTAATGGGTGTTTATATAATGG - Intergenic
1045672560 8:104572252-104572274 GGACATGGTTGTGACTATAAAGG + Intronic
1046132417 8:109982926-109982948 GGTCTTTGATGTTAAGAAAATGG - Intergenic
1046132511 8:109984456-109984478 GGTCTTTGATGTTAAGAAAATGG - Intergenic
1046491505 8:114958324-114958346 GTTCATGCATTTTAGTATAAAGG + Intergenic
1047594164 8:126360011-126360033 AGTAATGGATGCTAACATAAAGG + Intergenic
1059971982 9:119677562-119677584 GGTCTTGAATGTCAAGATAAGGG + Intergenic
1060387414 9:123244514-123244536 GGTAACAGATGTTAATAAAAGGG + Intronic
1185997666 X:4970428-4970450 GCTCATAAATGTTAATTTAAAGG + Intergenic
1186912754 X:14186487-14186509 GGTGATAGAAGTTAAAATAATGG - Intergenic
1188084535 X:25887196-25887218 TTTCAAGGATGTTTATATAAGGG - Intergenic
1188587614 X:31797066-31797088 GTTCATGTATGTTGCTATAAAGG - Intronic
1189161723 X:38815929-38815951 AGTCATGGACGTTTATAAAATGG - Intergenic
1189606759 X:42686421-42686443 GGTCATGTTTGTTAAAAGAAGGG - Intergenic
1190029304 X:46956411-46956433 TTTCAAGGATTTTAATATAATGG + Intronic
1194373848 X:93109068-93109090 GTTCATGTATGTTGCTATAAAGG + Intergenic
1195589139 X:106603667-106603689 GGTCAAGGGTGTTAATCTAATGG - Intergenic
1197343641 X:125305225-125305247 ATTCATGGCTGTTAAGATAAGGG + Intergenic
1197889690 X:131256987-131257009 GGGCATGTATGTTAATTTTATGG - Intergenic
1199351939 X:146811742-146811764 AGTCATTGATTTTAAAATAAAGG + Intergenic
1199351968 X:146812751-146812773 AGTCATTGATTTTAAAATAAAGG - Intergenic
1199463371 X:148108820-148108842 GGAGATGGATGTGAATATAAAGG - Intergenic
1200681877 Y:6223130-6223152 GTTCATGTATGTTGCTATAAAGG + Intergenic