ID: 962992960

View in Genome Browser
Species Human (GRCh38)
Location 3:140596319-140596341
Sequence GTGATCAATCACTTCTATGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962992960_962992963 16 Left 962992960 3:140596319-140596341 CCAACATAGAAGTGATTGATCAC No data
Right 962992963 3:140596358-140596380 TGTTGCACGTTCCTGCCCTATGG No data
962992960_962992965 28 Left 962992960 3:140596319-140596341 CCAACATAGAAGTGATTGATCAC No data
Right 962992965 3:140596370-140596392 CTGCCCTATGGACAGTCTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962992960 Original CRISPR GTGATCAATCACTTCTATGT TGG (reversed) Intergenic
No off target data available for this crispr