ID: 962996821

View in Genome Browser
Species Human (GRCh38)
Location 3:140636980-140637002
Sequence GAGTATGACTAAAAGGAAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962996821_962996824 -8 Left 962996821 3:140636980-140637002 CCTACTTCCTTTTAGTCATACTC No data
Right 962996824 3:140636995-140637017 TCATACTCAGAGACTACTTTGGG No data
962996821_962996826 18 Left 962996821 3:140636980-140637002 CCTACTTCCTTTTAGTCATACTC No data
Right 962996826 3:140637021-140637043 AAAACGAGACCCATTACTACTGG No data
962996821_962996830 29 Left 962996821 3:140636980-140637002 CCTACTTCCTTTTAGTCATACTC No data
Right 962996830 3:140637032-140637054 CATTACTACTGGGTAAGTCATGG No data
962996821_962996823 -9 Left 962996821 3:140636980-140637002 CCTACTTCCTTTTAGTCATACTC No data
Right 962996823 3:140636994-140637016 GTCATACTCAGAGACTACTTTGG No data
962996821_962996825 -7 Left 962996821 3:140636980-140637002 CCTACTTCCTTTTAGTCATACTC No data
Right 962996825 3:140636996-140637018 CATACTCAGAGACTACTTTGGGG No data
962996821_962996827 19 Left 962996821 3:140636980-140637002 CCTACTTCCTTTTAGTCATACTC No data
Right 962996827 3:140637022-140637044 AAACGAGACCCATTACTACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962996821 Original CRISPR GAGTATGACTAAAAGGAAGT AGG (reversed) Intergenic
No off target data available for this crispr