ID: 962996967

View in Genome Browser
Species Human (GRCh38)
Location 3:140639339-140639361
Sequence CAAGGTAAACAAAGAGCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962996967_962996971 3 Left 962996967 3:140639339-140639361 CCTTCTGCTCTTTGTTTACCTTG No data
Right 962996971 3:140639365-140639387 TTTTACAGGCTCTTTGAATTGGG No data
962996967_962996970 2 Left 962996967 3:140639339-140639361 CCTTCTGCTCTTTGTTTACCTTG No data
Right 962996970 3:140639364-140639386 CTTTTACAGGCTCTTTGAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962996967 Original CRISPR CAAGGTAAACAAAGAGCAGA AGG (reversed) Intergenic
No off target data available for this crispr