ID: 962997968

View in Genome Browser
Species Human (GRCh38)
Location 3:140650672-140650694
Sequence TGTGCCACGCAGCTGCCGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962997968_962997971 1 Left 962997968 3:140650672-140650694 CCTGGCGGCAGCTGCGTGGCACA No data
Right 962997971 3:140650696-140650718 AGAGAGAATGTATGTGCTTGGGG No data
962997968_962997972 2 Left 962997968 3:140650672-140650694 CCTGGCGGCAGCTGCGTGGCACA No data
Right 962997972 3:140650697-140650719 GAGAGAATGTATGTGCTTGGGGG No data
962997968_962997970 0 Left 962997968 3:140650672-140650694 CCTGGCGGCAGCTGCGTGGCACA No data
Right 962997970 3:140650695-140650717 CAGAGAGAATGTATGTGCTTGGG No data
962997968_962997974 6 Left 962997968 3:140650672-140650694 CCTGGCGGCAGCTGCGTGGCACA No data
Right 962997974 3:140650701-140650723 GAATGTATGTGCTTGGGGGAGGG No data
962997968_962997969 -1 Left 962997968 3:140650672-140650694 CCTGGCGGCAGCTGCGTGGCACA No data
Right 962997969 3:140650694-140650716 ACAGAGAGAATGTATGTGCTTGG No data
962997968_962997975 24 Left 962997968 3:140650672-140650694 CCTGGCGGCAGCTGCGTGGCACA No data
Right 962997975 3:140650719-140650741 GAGGGAGAGCAAAGTGATTGTGG No data
962997968_962997973 5 Left 962997968 3:140650672-140650694 CCTGGCGGCAGCTGCGTGGCACA No data
Right 962997973 3:140650700-140650722 AGAATGTATGTGCTTGGGGGAGG No data
962997968_962997976 25 Left 962997968 3:140650672-140650694 CCTGGCGGCAGCTGCGTGGCACA No data
Right 962997976 3:140650720-140650742 AGGGAGAGCAAAGTGATTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962997968 Original CRISPR TGTGCCACGCAGCTGCCGCC AGG (reversed) Intergenic
No off target data available for this crispr