ID: 962997976

View in Genome Browser
Species Human (GRCh38)
Location 3:140650720-140650742
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962997967_962997976 26 Left 962997967 3:140650671-140650693 CCCTGGCGGCAGCTGCGTGGCAC No data
Right 962997976 3:140650720-140650742 AGGGAGAGCAAAGTGATTGTGGG No data
962997968_962997976 25 Left 962997968 3:140650672-140650694 CCTGGCGGCAGCTGCGTGGCACA No data
Right 962997976 3:140650720-140650742 AGGGAGAGCAAAGTGATTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type