ID: 963001194

View in Genome Browser
Species Human (GRCh38)
Location 3:140683282-140683304
Sequence CAGGGTAGCACAGTGTTTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 339
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 315}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963001194_963001195 -7 Left 963001194 3:140683282-140683304 CCAGGAAACACTGTGCTACCCTG 0: 1
1: 0
2: 1
3: 22
4: 315
Right 963001195 3:140683298-140683320 TACCCTGCAAGTCACTATCCTGG 0: 1
1: 0
2: 1
3: 4
4: 67
963001194_963001198 6 Left 963001194 3:140683282-140683304 CCAGGAAACACTGTGCTACCCTG 0: 1
1: 0
2: 1
3: 22
4: 315
Right 963001198 3:140683311-140683333 ACTATCCTGGTGTCCGCTCCTGG 0: 1
1: 0
2: 0
3: 3
4: 57

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963001194 Original CRISPR CAGGGTAGCACAGTGTTTCC TGG (reversed) Intronic
900362646 1:2297343-2297365 CAGCGTAGCAGAGTGTTGCTGGG + Intronic
900363705 1:2301906-2301928 CAGGACAGCACAGAGTCTCCAGG - Intronic
902544685 1:17182767-17182789 CAGGGTTTCACAGTGTTAGCCGG + Intergenic
903212159 1:21824381-21824403 CAGGGAAGCACAGGGTCTCTGGG + Exonic
903437010 1:23357726-23357748 TAGGTTAGGACTGTGTTTCCAGG - Intergenic
903625674 1:24728638-24728660 CAGGGTTTCACCGTGTTGCCAGG + Intergenic
904210134 1:28881858-28881880 CAGGGTCTCACCGTGTTGCCAGG + Intergenic
904921160 1:34009422-34009444 CAGGGCGGCACAGTGTCTCCTGG - Intronic
905056484 1:35098713-35098735 CAGGGTTTCACTGTGTTGCCAGG - Intronic
905213247 1:36388987-36389009 CAGGGTCTCACTGTGTTGCCAGG + Intergenic
905814277 1:40936613-40936635 CTGGTTAGCACAGTGGTCCCAGG - Intergenic
906711693 1:47934959-47934981 CAGGGTTGGACAGTGTTTTTCGG - Intronic
907124793 1:52040247-52040269 CAGGGTCTCACTCTGTTTCCAGG + Intronic
907803927 1:57799482-57799504 CACGGTTTCAAAGTGTTTCCAGG + Intronic
908217740 1:61971800-61971822 TAGGGTCTCACAATGTTTCCAGG - Intronic
908713649 1:67046777-67046799 AGGGGCAACACAGTGTTTCCTGG - Intronic
909543427 1:76816535-76816557 GGGAGTTGCACAGTGTTTCCTGG - Intergenic
911188040 1:94923179-94923201 AAGGGAAGCACAGTATTTCCTGG - Intronic
911594380 1:99783895-99783917 CAGGGTCTCACTCTGTTTCCAGG + Intergenic
911752720 1:101516241-101516263 CAGGGTCCCACAATGTTGCCAGG - Intergenic
912571524 1:110627802-110627824 CAGGGTCTCACTGTTTTTCCAGG - Intronic
912712741 1:111961292-111961314 CCGGCTGGCACAATGTTTCCTGG + Intronic
913002600 1:114596180-114596202 CAGGGTCTCACTGTGTTGCCAGG - Intronic
913370374 1:118092463-118092485 CAGGGTAGTTCAGTGATCCCAGG - Intronic
915487678 1:156233346-156233368 CAGGGTTTCACCGTGTTACCAGG + Intronic
915946525 1:160156313-160156335 CAGGGTTTCACAGCTTTTCCAGG - Intronic
916207612 1:162330750-162330772 CAGAGCAGCACACTGTTTACAGG + Intronic
916697825 1:167257973-167257995 CAGGGTCTCACTATGTTTCCAGG + Intronic
916892109 1:169122027-169122049 CAAGGTTAAACAGTGTTTCCAGG - Intronic
917953015 1:180061218-180061240 CAGGGTCTCACTCTGTTTCCTGG + Intronic
918130841 1:181627628-181627650 CTGGGCAGCACAGTGGTTCAGGG + Intronic
919463660 1:197907981-197908003 CTGGTTAGCAAAGGGTTTCCTGG - Intergenic
920010108 1:202861218-202861240 CAGGGTAGAAAAGTGGTGCCGGG + Intergenic
921041552 1:211437774-211437796 CAGGGTTGCACTATGTTGCCCGG - Intergenic
922218536 1:223540208-223540230 CAGGAGAGCTCAGTGTCTCCTGG - Intronic
923831691 1:237565456-237565478 CAGGGTACCACTATGTTGCCCGG + Intronic
924593805 1:245427970-245427992 CAGGCTGGCACAGTGTTGGCTGG - Intronic
1063147385 10:3308563-3308585 CAGAGGAGCAGAGTGTTCCCAGG + Intergenic
1065451913 10:25868167-25868189 CAGGGTTTCACCGTGTTGCCCGG - Intergenic
1066427378 10:35319923-35319945 CAGAGTGTCACAGTGTCTCCCGG - Intronic
1067190666 10:44065314-44065336 TAGGGTGGCAGAGTGTTGCCAGG - Intergenic
1067980478 10:51078807-51078829 CGGGGTTTCACAGTGTTACCAGG + Intronic
1068034215 10:51739779-51739801 CAGGGTTTCACCATGTTTCCAGG - Intronic
1068159943 10:53250747-53250769 CAGGGTTTCACCATGTTTCCTGG + Intergenic
1069556616 10:69402530-69402552 CAGGGTCTCACTGTGTTGCCAGG + Intergenic
1069632932 10:69908480-69908502 CAGGGCAGCAGAGGGTCTCCAGG + Intronic
1071205586 10:83272483-83272505 CAGGGTAGAAGAGTTTTGCCAGG - Intergenic
1071862690 10:89690531-89690553 CAGGTCAGCATAGTGATTCCAGG + Intergenic
1072419900 10:95281386-95281408 CAGGGTCCCACTGTGTTGCCCGG - Intronic
1073157593 10:101360243-101360265 CAGGGTTTCACCGTGTTGCCCGG + Intronic
1073721772 10:106181036-106181058 CAGGGTACCACAGAGTTTAAAGG - Intergenic
1074413789 10:113249646-113249668 CTGGGTAGGAAAGTGTTTGCAGG + Intergenic
1075451507 10:122554922-122554944 GAGGGTAGCACAGAGGATCCGGG + Intergenic
1077474341 11:2779274-2779296 CAGGGAAACACCGTGTTCCCCGG - Intronic
1077745637 11:4901350-4901372 CGGGGTTTCACAGTGTTTGCCGG + Intronic
1078234453 11:9471339-9471361 CAGGGAATGACAGAGTTTCCTGG + Exonic
1078255590 11:9655877-9655899 CAGGGTTTCACCGTGTTGCCAGG - Intergenic
1079354975 11:19723181-19723203 TAGGATAGGACAGAGTTTCCAGG + Intronic
1079430414 11:20384419-20384441 CAGGGAAGCAAAGTGATTCGAGG + Intergenic
1079901847 11:26197089-26197111 CAGGGTATGCCAGTGATTCCTGG - Intergenic
1083033251 11:59613942-59613964 CTGGGTAGCAGAATGATTCCTGG + Intronic
1083149762 11:60784433-60784455 CAGGGTCACACTGTGTTGCCCGG + Intergenic
1083598388 11:63931225-63931247 AAGGGAAGAACAGTGTTTCAAGG + Intergenic
1083734823 11:64673845-64673867 CAGGGTTTCACCGTGTTGCCAGG - Intronic
1083734947 11:64674759-64674781 CTGGTTATCTCAGTGTTTCCAGG - Intronic
1085537849 11:77235761-77235783 CAGGGTCTCACTGTGTTGCCAGG - Intronic
1085679965 11:78564088-78564110 CAGGGTTTCACCGTGTTGCCAGG + Intronic
1088351132 11:108889107-108889129 CAGGATCTTACAGTGTTTCCAGG + Intronic
1090068602 11:123525147-123525169 CAGGGCAGCACATTGTCACCTGG - Intergenic
1090253923 11:125269870-125269892 CACAGTAGCAAAGAGTTTCCTGG + Intronic
1090872932 11:130763838-130763860 CATAGTAGCACAGAGTTGCCAGG + Intergenic
1091696746 12:2632944-2632966 CTGGGTGCCCCAGTGTTTCCAGG - Intronic
1093782516 12:23153428-23153450 CAGGGTCTCACAGTGTTGTCCGG + Intergenic
1094467448 12:30768696-30768718 CAGGGTCTCACTATGTTTCCAGG + Intergenic
1095757368 12:45784012-45784034 CAGGGTCTCACTGTGTTGCCTGG + Intronic
1096668869 12:53185885-53185907 CAGAGTAGAACAGTGTCTCCAGG + Intronic
1098947155 12:76601571-76601593 CAGGGTCTCACTCTGTTTCCCGG - Intergenic
1100331371 12:93585477-93585499 CAGGGGAGAACTGTGCTTCCTGG - Intergenic
1101074423 12:101113732-101113754 TAGGGTAGTACAGTGATTGCTGG + Intronic
1102059406 12:109921481-109921503 CAGGGTCCCACTGTGTTGCCAGG - Intronic
1103730366 12:123023175-123023197 CAGGGTAGAAATGTGTCTCCTGG + Intronic
1104328534 12:127823113-127823135 CAGGAGAGCACAGCGTGTCCAGG - Intergenic
1104433446 12:128735924-128735946 CAGGGTTTCACCGTGTTGCCCGG - Intergenic
1108379701 13:49844193-49844215 CAGGGTAGCAAAGTGTAGCAGGG + Intergenic
1108661774 13:52594548-52594570 CAGGGCAGCACTGTGGTCCCTGG - Intergenic
1109123375 13:58486880-58486902 CAGGGTTTCACCGTGTTACCCGG - Intergenic
1110519291 13:76456387-76456409 CAGGCTTGGACAGGGTTTCCTGG - Intergenic
1111411048 13:87877205-87877227 CGGGGTTTCACAGTGTTACCAGG - Intergenic
1112603373 13:100879209-100879231 CAGGGACAAACAGTGTTTCCAGG - Intergenic
1112914648 13:104532945-104532967 CACTGAAGCACAGTGTTTCTTGG + Intergenic
1113114233 13:106857890-106857912 CAGGGTCTCACTATGTTTCCTGG - Intergenic
1113151525 13:107269135-107269157 CAGGGTCTCACTGTGTCTCCCGG - Intronic
1114290243 14:21282068-21282090 CAGAGTATCACATTGTTGCCTGG - Intergenic
1114780990 14:25537954-25537976 CAGGGTAGCTCTGGGTTTTCTGG + Intergenic
1116483687 14:45421005-45421027 CAGGGTTTCACTGTGTTGCCAGG - Intergenic
1119455886 14:74755303-74755325 CAGGGTTTCACAGTGTTGGCTGG - Intergenic
1119689839 14:76662925-76662947 AAGGTTAGCACAGTGTGTCTGGG - Intergenic
1120086816 14:80284909-80284931 CAAGGTAGAATAGTGGTTCCAGG - Intronic
1121667940 14:95686618-95686640 CAGGGCAGCAGAGTGAGTCCTGG + Exonic
1122945907 14:105009038-105009060 CAGGGTTTCACCGTGTTGCCAGG - Intronic
1125702945 15:41704464-41704486 CAGGGTTTCACCGTGTTACCAGG - Intronic
1126166359 15:45657478-45657500 CAGGCTCATACAGTGTTTCCAGG - Intronic
1127528018 15:59813215-59813237 CAGGGAAGCACATTCTTTCCAGG + Intergenic
1128507222 15:68282116-68282138 CAGGCCAGCACAATGTTTCATGG - Intronic
1129365298 15:75050404-75050426 CTGGGTAGCAGAGGGTTTCTGGG - Exonic
1130209475 15:81910049-81910071 CAGGGAAGAACAGTGGTGCCAGG - Intergenic
1131017552 15:89070676-89070698 CAAGGTTACACAGTGTTTACAGG + Intergenic
1131106073 15:89735857-89735879 CAGGGGAGGACTGTGTTTTCTGG + Intronic
1131957048 15:97748028-97748050 CAGGACAGCACTGTGTTTCAGGG - Intergenic
1134056686 16:11174547-11174569 CAGAGAAGGACAGCGTTTCCAGG - Intronic
1135331789 16:21566536-21566558 CAGGGTTTCACCGTGTTGCCCGG - Intergenic
1136087996 16:27899256-27899278 CAGTGTAGCCCAGTGTTTAAGGG + Intronic
1136391424 16:29967416-29967438 CAGGGTATCACTGTATTGCCCGG - Intronic
1137327492 16:47456498-47456520 CAGGGTTTCACCGTGTTGCCCGG - Intronic
1139214080 16:65110377-65110399 CTGGGCAGCACAGTCTTTGCAGG + Intronic
1139905524 16:70363040-70363062 CAGGGTATCACTATGTTGCCAGG + Intronic
1140499581 16:75422286-75422308 CAGGGTTTCACCGTGTTGCCAGG + Intronic
1141133611 16:81451580-81451602 GAGGGAAGGGCAGTGTTTCCTGG + Intronic
1143166193 17:4898320-4898342 CAGGGAAGAAGAGGGTTTCCTGG + Exonic
1143517605 17:7427561-7427583 CAGACCACCACAGTGTTTCCTGG - Exonic
1146757850 17:35448896-35448918 CAGCGTGGCAAAGTGTTCCCGGG - Intergenic
1147012311 17:37460102-37460124 CAGGGTCTCACAATGTTGCCTGG + Intronic
1148056886 17:44804436-44804458 AAGGGAAACACAGTGTTCCCAGG - Exonic
1149168260 17:53779923-53779945 CCGGGTAGCACAGTCCTTCATGG - Intergenic
1149686016 17:58535247-58535269 CTGGGGAACACTGTGTTTCCTGG + Intronic
1151607294 17:75146342-75146364 CAGGGTTTCACCATGTTTCCAGG + Intronic
1151633796 17:75329700-75329722 CAGGGTCTCACTGTGTTGCCCGG - Intronic
1156427455 18:37029554-37029576 CAGGGTTTCACCGTGTTGCCAGG + Intronic
1157154813 18:45255132-45255154 AAGGGTAGCACAGTGTGTTCGGG - Intronic
1158985888 18:62816371-62816393 CAGGGTTTCACAGTGTTACTTGG - Intronic
1160196254 18:76758118-76758140 CAGTGCAGCACTGTCTTTCCAGG + Intergenic
1160720524 19:595175-595197 CAGGGTCTCACTCTGTTTCCCGG - Intronic
1161531922 19:4794837-4794859 CTGGGTGGCAAAGTGTTTTCAGG - Exonic
1161929286 19:7325730-7325752 CAGGGTCTCACTGTGTTGCCCGG - Intergenic
1162009974 19:7807161-7807183 CAGGGTCTCACTATGTTTCCTGG + Intergenic
1162460656 19:10812113-10812135 CAGGGTGGAACTGGGTTTCCTGG + Intronic
1163236709 19:16034227-16034249 CAGGGTTGGTCAGTGTGTCCTGG + Intergenic
1164985612 19:32646258-32646280 CAGGGTCTCACTATGTTTCCAGG + Intronic
1165468632 19:35990116-35990138 CAGGGCATCACAGGGTTCCCAGG - Intergenic
1165615218 19:37193585-37193607 CAGGGTCTCACTGTGTTGCCTGG - Intronic
1166209842 19:41299278-41299300 CAGGGAAGAACATTTTTTCCTGG + Intronic
1167515776 19:49922415-49922437 GAGGGGAGGACAGTGTTTCTGGG - Intronic
1167852870 19:52215246-52215268 CAGGGTTTCACTGTGTTGCCCGG + Intronic
925322455 2:2984912-2984934 CAGGGTTTCACCGTGTTGCCCGG - Intergenic
925871222 2:8272397-8272419 CAGGTGAGCAAAGCGTTTCCAGG - Intergenic
925929970 2:8699048-8699070 CCGGGGTGCACAGTGTTTGCTGG - Intergenic
926665376 2:15516364-15516386 CAGGGTAGGAAAATGTTTACAGG - Intronic
927161053 2:20261899-20261921 CAGGGTCTCACTGTGTTGCCAGG - Intronic
927168433 2:20348730-20348752 CAGGGTCTCACTGTGTTTCCTGG - Intronic
927429314 2:23013565-23013587 GAGGGAAGCACAGTGGTTACAGG - Intergenic
927987687 2:27424565-27424587 CAGGGTCGCACTATGTTGCCCGG + Intergenic
928147362 2:28791353-28791375 CAGAGTCTCACACTGTTTCCCGG + Intronic
928611339 2:32995156-32995178 CAGGGTCTCACACTGTTGCCAGG - Intronic
928636244 2:33250075-33250097 CTGGGTAGCATATTGTTTCTGGG + Intronic
929809580 2:45178509-45178531 CAGGGCTCCACAGTGTTCCCAGG - Intergenic
929847030 2:45541243-45541265 GAGGGGAACACAGTGGTTCCTGG + Intronic
931326080 2:61225048-61225070 CTGGGTTGTACAGGGTTTCCAGG + Intronic
931902089 2:66800923-66800945 CAGCTTAGCACAGTGGTTCAGGG - Intergenic
932818638 2:74881294-74881316 CAGTGTAGCACAGTTGTTACAGG + Intronic
933995808 2:87668931-87668953 AGGGGTATCACAGTGTTTTCTGG + Intergenic
934782673 2:96981874-96981896 CAGGGTTTCACTGTGTTGCCTGG - Intronic
935121670 2:100188417-100188439 CAGGGTCTCACTGTGTTGCCAGG + Intergenic
935256499 2:101314426-101314448 CGGGGTTTCACCGTGTTTCCAGG + Intergenic
935455088 2:103257911-103257933 CAGGGTATGACATTTTTTCCAGG - Intergenic
936198071 2:110386736-110386758 CAGGGCAGCACAGAGGGTCCAGG + Intergenic
936226978 2:110663833-110663855 CAGGGTTTCACCGTGTTACCAGG - Intronic
936298049 2:111281981-111282003 AGGGGTATCACAGTGTTTTCTGG - Intergenic
939133804 2:138271071-138271093 CAGGGTCGCACTATGTTGCCTGG + Intergenic
939268508 2:139907884-139907906 CAGGATCTCACTGTGTTTCCTGG + Intergenic
940270540 2:151885082-151885104 AAGGGTAGCATAGATTTTCCTGG + Intronic
940297682 2:152145257-152145279 CAGGGTCTCACTATGTTTCCTGG + Intronic
941683701 2:168426431-168426453 TAGACTAGCACAGTGTGTCCAGG + Intergenic
943622415 2:190164342-190164364 CAGGGTTTCACCATGTTTCCCGG - Intronic
947670992 2:231935191-231935213 CAGGGCAGCCCTGTGTCTCCTGG + Intergenic
947945527 2:234098464-234098486 CAGAGTAACTCAGTGTCTCCAGG + Intergenic
948136392 2:235639403-235639425 CGGGGAATCCCAGTGTTTCCAGG + Intronic
948800664 2:240432037-240432059 CAGGGTACCACTGAGTGTCCAGG + Intergenic
948829341 2:240590439-240590461 GAGGGCAGCAGAGTGTGTCCCGG + Intronic
948856165 2:240731692-240731714 CAGGCAAGCTCACTGTTTCCTGG + Intronic
1169203093 20:3724270-3724292 CAGAGTATCACTGTGTTGCCAGG - Intergenic
1169206511 20:3743384-3743406 CAGGGTCTCACTGTGTTGCCAGG + Intronic
1169733163 20:8809020-8809042 CAGGGTCTCACTGTGTTTCCTGG + Intronic
1169964814 20:11205047-11205069 CAAGGAACCATAGTGTTTCCAGG + Intergenic
1170644513 20:18185390-18185412 CAGGGTCTCACTGTGTTGCCTGG + Intronic
1171016996 20:21550921-21550943 CAGGGTCTCTCAGTGTTGCCTGG - Intergenic
1171499037 20:25578948-25578970 CAGGGTTTCACTGTGTTGCCTGG - Intronic
1172402850 20:34664796-34664818 CAGGGTTTCACCATGTTTCCAGG - Intronic
1172761885 20:37328805-37328827 CAGGATAGGACAGTCTCTCCTGG - Intergenic
1174625120 20:51907798-51907820 CAGGGTCTCACTGTGTTGCCAGG - Intergenic
1174706937 20:52666587-52666609 GAGAGTAGAACAGTGTTTACGGG - Intergenic
1174877766 20:54246175-54246197 CAGGGTTTCACAGTGTTGGCCGG + Intergenic
1177756750 21:25357694-25357716 TGGGGTAGCAAAATGTTTCCTGG + Intergenic
1178271056 21:31190213-31190235 CAGGGTCTCACTGTGTTGCCAGG - Intronic
1178586711 21:33876699-33876721 CAGGGTCTCACTCTGTTTCCAGG - Intronic
1178809257 21:35866438-35866460 CAGGGTCTCCCAGTGTTGCCAGG - Intronic
1179710338 21:43209678-43209700 CAGTGTGGGACAGTGTTGCCTGG + Intergenic
1180985566 22:19902156-19902178 CAGGGTCTCACTCTGTTTCCCGG - Intronic
1181543275 22:23585708-23585730 CAGGGTCTCACTGTGTTGCCCGG + Intergenic
1181936692 22:26443787-26443809 CAGGGTGGCACACAGTGTCCAGG + Exonic
1181959791 22:26614941-26614963 GAGGATAGGACAGTATTTCCTGG + Intronic
1184386213 22:44176138-44176160 CAGGGAAGCACAGTTGTCCCTGG + Intronic
1184656397 22:45944102-45944124 CAGGGTAACACAGTGGGACCCGG + Intronic
1184681819 22:46076403-46076425 CAGGGCTGCCCAGTGTTCCCTGG + Intronic
1184794854 22:46726266-46726288 CAGGGGAGCACAGCGGTCCCTGG + Intronic
1185025715 22:48410676-48410698 CAGTGTGGTACAGTGATTCCAGG - Intergenic
949099847 3:130515-130537 CAGGCTAGCCCATTGGTTCCAGG - Intergenic
951718373 3:25673217-25673239 CTGGGTACCACTGTGTTCCCTGG - Intergenic
952793437 3:37218244-37218266 CAGGGCACCACTGTGTTCCCTGG + Intergenic
952943622 3:38461125-38461147 CAGTGGCGCACAGTGTTTTCAGG + Intronic
953923764 3:46969925-46969947 CAGGGTCTCACACTGTTGCCCGG + Intronic
953984309 3:47429538-47429560 CAGGGTATCACTATGTTGCCAGG + Intronic
954009227 3:47620270-47620292 CAGGGTTTCACTGTGTTGCCTGG - Intronic
955087902 3:55720797-55720819 CAGGGTAGCACTGTGCTTCAAGG - Intronic
956204961 3:66745802-66745824 GAGGGTACCACAGAGTTTCTTGG + Intergenic
962028077 3:131569611-131569633 CAGGGTCTCACTCTGTTTCCCGG - Intronic
962574926 3:136747966-136747988 CAGGGTTTCACCGTGTTGCCAGG + Intronic
962957411 3:140278909-140278931 CAGGGTCTCACTATGTTTCCTGG + Intronic
963001194 3:140683282-140683304 CAGGGTAGCACAGTGTTTCCTGG - Intronic
963972382 3:151444081-151444103 CAGGGTCTCACTATGTTTCCAGG - Intronic
964347780 3:155771585-155771607 CAGGGTTTCACAATGTTGCCAGG + Intronic
964511649 3:157459174-157459196 CAGGGCAGCACGGAGTTCCCAGG + Intronic
964991663 3:162820200-162820222 CAGGGTTTCACCGTGTTGCCAGG + Intergenic
965206069 3:165720196-165720218 CTGGGTACCACTGTGTTTCCCGG - Intergenic
965382383 3:168005935-168005957 AAGGGTTGAACAGTGTTTCCGGG + Intergenic
966634225 3:182114468-182114490 CAAGTTAGGACAATGTTTCCTGG - Intergenic
967071031 3:185962444-185962466 CAGGGTCTCACTGTGTTGCCTGG + Intergenic
967088317 3:186113690-186113712 CAGGGCAGCAGAGTGGCTCCTGG - Intronic
967341859 3:188407335-188407357 CAGACTAGTAAAGTGTTTCCTGG - Intronic
968311562 3:197687868-197687890 CAGGGCAGCTCTGTGTTTCAGGG + Intronic
968398464 4:266080-266102 CAGGGTTTCACCGTGTTGCCAGG - Intergenic
968745348 4:2357085-2357107 CAGGGTTTCACTGTGTTGCCTGG + Intronic
968805530 4:2769201-2769223 CAGGGTGTCACAGGGTGTCCAGG + Intergenic
969441376 4:7218931-7218953 CACGGGAGCACTGTGTTTCAGGG - Intronic
969508148 4:7601074-7601096 CAGGGTTTCGCCGTGTTTCCTGG + Intronic
972416022 4:38841398-38841420 CAGGGTTTCACTGTGTTGCCCGG - Intronic
972446819 4:39152205-39152227 CAGGGTCTCACCGTGTTGCCCGG - Intergenic
972678515 4:41283608-41283630 CAGGGTTTCACTGTGTTGCCCGG + Intergenic
973003550 4:44982222-44982244 CAGGGTTTCACCGTGTTGCCAGG - Intergenic
973069852 4:45844747-45844769 AATGGTAGCACAGTGTTTGTGGG - Intergenic
973882840 4:55291139-55291161 CAGAGGAGCACAGTGTTCCTGGG - Intergenic
974302001 4:60081229-60081251 CAGGGTAGCACAGTCCCTCATGG - Intergenic
975593164 4:76020287-76020309 CAGGGTCTCACTGTGTTTCCAGG + Intronic
976467225 4:85384463-85384485 CAGGGTCTCACTCTGTTTCCTGG + Intergenic
976601916 4:86945688-86945710 CAAGGTGTCACTGTGTTTCCAGG + Intronic
982012959 4:151124525-151124547 CAGGGTTTCACTGTGTTGCCGGG - Intronic
982506444 4:156224181-156224203 AAGGGAAGCTCAGTGTTTACAGG - Intergenic
983920713 4:173341322-173341344 CAGGGTTTCACAGTGTTTAGTGG + Intergenic
984365318 4:178792003-178792025 CAGTGTAGCACAGTATTTAAGGG - Intergenic
986201646 5:5584654-5584676 CAGGGTAGTACAGTGTGACCAGG + Intergenic
987147716 5:15008725-15008747 CAGGGAACCACAGCGCTTCCCGG - Intergenic
992905192 5:81338888-81338910 CAGGGTTTCACCATGTTTCCAGG - Intronic
993303855 5:86250108-86250130 CAGGGTTTCACAATGTTTCCAGG + Intergenic
995971951 5:117983322-117983344 CAGGGTTTCACCGTGTTGCCTGG - Intergenic
998000911 5:138625002-138625024 CAGGGTCTCACTCTGTTTCCAGG - Intronic
998106188 5:139470936-139470958 CAGGGTAGCCCAGATGTTCCCGG + Intergenic
998632980 5:143921048-143921070 CAGGTTAGAACAGTTTTTCTGGG + Intergenic
998646993 5:144073012-144073034 CAGGGTAGCATCCTGTTTCCTGG + Intergenic
1000181192 5:158812999-158813021 CAGGGTCCTACACTGTTTCCTGG + Intronic
1004001601 6:11601705-11601727 CAGGGTTTCACTGTGTTGCCCGG + Intergenic
1006535927 6:34698661-34698683 CAGGGTCTCACTGTGTTGCCCGG + Intergenic
1006704280 6:36004265-36004287 CAGGGTGTCACTGTGTTGCCAGG + Intronic
1006998274 6:38283702-38283724 CAGGGTAAGAGAGGGTTTCCAGG + Intronic
1007842899 6:44731205-44731227 TAGGGAATCACAGTGTTTCCCGG + Intergenic
1008607246 6:53152177-53152199 CAGGGTCTCACTGTGTTGCCAGG + Intergenic
1009029505 6:58039408-58039430 CAGGGTCTCACTGTGTTGCCAGG + Intergenic
1009168829 6:60373768-60373790 CAGGGTTTCACCGTGTTGCCAGG + Intergenic
1013367872 6:109448642-109448664 CAGGGAAGCACACTGTCTCTAGG + Intronic
1013438504 6:110138248-110138270 CTGGGCACCACAGTGTTCCCTGG - Intronic
1013771770 6:113635527-113635549 CAGGGTAGCACAATGTCTCCAGG + Intergenic
1014020792 6:116586747-116586769 TATGGTAGTTCAGTGTTTCCTGG + Intronic
1014296633 6:119626598-119626620 GAGAGTAGAACAGTGGTTCCAGG + Intergenic
1016404711 6:143717761-143717783 CAGGGTTTCACTGTGTTGCCGGG + Intronic
1017132682 6:151121579-151121601 CAGGGTTGCACAATGTTGGCCGG + Intergenic
1017137017 6:151156790-151156812 CAGGGTTTCACCGTGTTGCCAGG - Intergenic
1018572751 6:165227999-165228021 TAGGGAAGCAGCGTGTTTCCAGG - Intergenic
1018949250 6:168368493-168368515 CAGGATAGCAGGGTCTTTCCTGG + Intergenic
1019273372 7:163143-163165 CAAGGCAGCACAGTGTTGCATGG - Intergenic
1021103142 7:16606705-16606727 CAGTGTAGGACATTGTTACCAGG - Intronic
1021734012 7:23625032-23625054 CAGGGTCTCACTGTGTTGCCCGG + Intronic
1022216754 7:28270589-28270611 CAGGGTGCCACTGTGTTCCCTGG + Intergenic
1022472829 7:30692302-30692324 AAGGGGGGCACAGGGTTTCCAGG - Intronic
1023157496 7:37265689-37265711 CAGGTGAGCAAAGTGTTTCAAGG - Intronic
1023213588 7:37834426-37834448 CAGGGTTTCTCTGTGTTTCCTGG + Intronic
1023220866 7:37919241-37919263 AAGAGTAGAACAGTGGTTCCTGG - Intronic
1023560205 7:41466113-41466135 TTCGGTGGCACAGTGTTTCCTGG - Intergenic
1025208200 7:57005450-57005472 CAGGGTCTCACTGTGTTGCCTGG + Intergenic
1025663754 7:63571428-63571450 CAGGGTCTCACTGTGTTGCCTGG - Intergenic
1025870882 7:65433219-65433241 CAGGGTTTCACCGTGTTGCCAGG - Intergenic
1026187347 7:68092254-68092276 CAGGGTCTTGCAGTGTTTCCTGG - Intergenic
1028775134 7:94667119-94667141 CAGGTTAGCACAAAGCTTCCAGG - Exonic
1028783812 7:94769094-94769116 CAGGGTTGCACCATGTTGCCTGG + Intergenic
1030252259 7:107460210-107460232 CAGGGTCTCACCGTGTTGCCTGG - Intronic
1030933288 7:115552159-115552181 CAGGGTTTCACTGTGTTACCAGG + Intergenic
1031716473 7:125114956-125114978 CAGGGTCTCACTTTGTTTCCTGG + Intergenic
1031831208 7:126628236-126628258 CAGGGTTTCACTGTGTTGCCAGG + Intronic
1032082896 7:128869041-128869063 CAGGGGAACACAGTAGTTCCAGG + Intronic
1033767660 7:144511636-144511658 CACGTTAGCACAGTGGTACCTGG + Intronic
1034676451 7:152895937-152895959 CAGGGAACCTCAGTGTTACCGGG - Intergenic
1037434443 8:18847780-18847802 CAGGGTAGCCTTGTGTTTGCGGG - Intronic
1038606216 8:29007624-29007646 CAGGGTCTCACAATGTTGCCAGG - Intronic
1038783727 8:30591457-30591479 CAGGGTCTCACTCTGTTTCCTGG - Intronic
1040571757 8:48617543-48617565 CAGTGTGGCTCAGTGTTTGCAGG + Intergenic
1041791168 8:61697811-61697833 CAGAGTCTCACTGTGTTTCCCGG + Intronic
1042146300 8:65733592-65733614 CAGGGTTTCACAGTGTTGCCAGG - Intronic
1042928083 8:73987368-73987390 CAGGGTTTCACTGTGTTGCCAGG - Intergenic
1043309838 8:78844337-78844359 CAGGGTAGTTCAGTACTTCCAGG + Intergenic
1044304514 8:90622428-90622450 CAGGTTAGTACTGTTTTTCCTGG + Exonic
1044627825 8:94251613-94251635 GAGAGTAGGACAGTGTTTCTAGG + Intronic
1047287053 8:123496346-123496368 CAGAATTGCACTGTGTTTCCAGG - Intergenic
1047958342 8:129992958-129992980 TCTGGTAGCATAGTGTTTCCTGG + Intronic
1049834459 8:144725481-144725503 CAGGGTCTCACTGTGTTGCCAGG + Intronic
1050509906 9:6383638-6383660 CAGGGTTTCACAGTGTTAGCCGG - Intergenic
1052758358 9:32565265-32565287 CAGGGTCTCACTGTGTCTCCTGG - Intronic
1053124452 9:35568489-35568511 CAGGGTCTCACTGTGTTGCCTGG - Intergenic
1053579722 9:39391985-39392007 CAGGGTGGCAGAGTGTGTCCGGG - Intergenic
1054101309 9:60950794-60950816 CAGGGTGGCAGAGTGTGTCCGGG - Intergenic
1054122682 9:61226157-61226179 CAGGGTGGCAGAGTGTGTCCGGG - Intergenic
1054585042 9:66956087-66956109 CAGGGTGGCAGAGTGTGTCCGGG + Intergenic
1054895367 9:70304267-70304289 CAGGGTCTCACTTTGTTTCCTGG + Intronic
1054936164 9:70690631-70690653 CAGCTTAGCATAATGTTTCCTGG + Intronic
1054991353 9:71330839-71330861 AAGGGAACCACAGTCTTTCCTGG + Intronic
1055489295 9:76788425-76788447 CACTGTAGCACAGTGGTCCCAGG + Intronic
1055777601 9:79782802-79782824 CAAGGATTCACAGTGTTTCCTGG + Intergenic
1056788759 9:89611631-89611653 CAGAATAGAACAGTGTTTCTGGG + Intergenic
1057166707 9:92933254-92933276 CAGGGTTTCACAGTGTTGGCCGG + Intergenic
1060067719 9:120517867-120517889 CAGGGTCTCACTCTGTTTCCTGG - Intronic
1060199226 9:121642513-121642535 CAGGGTCTCACTGTGTTGCCAGG + Intronic
1060297304 9:122351405-122351427 CAGCATAGCACAGTGGTTACAGG + Intergenic
1061452838 9:130677915-130677937 CAGTGTACCCCAATGTTTCCTGG + Intronic
1203739988 Un_GL000216v2:170819-170841 CAGGGTGGCCCGGTGTTTCCCGG + Intergenic
1185590070 X:1270427-1270449 GAGGGTTTCACTGTGTTTCCCGG + Intronic
1189819245 X:44854345-44854367 CAGGGTCTCACAGTGTCACCTGG - Intergenic
1190522263 X:51292589-51292611 CAGGCTAGAACAGGCTTTCCAGG - Intergenic
1191852359 X:65594831-65594853 GAGGGGAGCCCAGTGTTTCATGG + Intronic
1196633775 X:117975736-117975758 CATGGTAGTGAAGTGTTTCCAGG + Intronic
1198100534 X:133418230-133418252 CAAGTTTGCACAGTGCTTCCAGG + Intergenic
1198877697 X:141244628-141244650 CAGGGTTTCACCGTGTTGCCAGG - Intergenic
1202054375 Y:20814553-20814575 CAGGGTGGTACTGTGCTTCCAGG - Intergenic
1202096347 Y:21251513-21251535 CCAGGTAGCACAGTGTTTCATGG + Intergenic