ID: 963002024

View in Genome Browser
Species Human (GRCh38)
Location 3:140690791-140690813
Sequence TCTTGGAAGACTGTGTGATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 251
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 235}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963002024_963002032 24 Left 963002024 3:140690791-140690813 CCTCATCACACAGTCTTCCAAGA 0: 1
1: 0
2: 0
3: 15
4: 235
Right 963002032 3:140690838-140690860 CTTCGGTAGCTACAGGGGATGGG 0: 1
1: 0
2: 0
3: 27
4: 191
963002024_963002028 17 Left 963002024 3:140690791-140690813 CCTCATCACACAGTCTTCCAAGA 0: 1
1: 0
2: 0
3: 15
4: 235
Right 963002028 3:140690831-140690853 TAAAAGTCTTCGGTAGCTACAGG 0: 1
1: 0
2: 0
3: 3
4: 60
963002024_963002029 18 Left 963002024 3:140690791-140690813 CCTCATCACACAGTCTTCCAAGA 0: 1
1: 0
2: 0
3: 15
4: 235
Right 963002029 3:140690832-140690854 AAAAGTCTTCGGTAGCTACAGGG 0: 1
1: 0
2: 0
3: 12
4: 458
963002024_963002027 7 Left 963002024 3:140690791-140690813 CCTCATCACACAGTCTTCCAAGA 0: 1
1: 0
2: 0
3: 15
4: 235
Right 963002027 3:140690821-140690843 ATGGTCTAATTAAAAGTCTTCGG 0: 1
1: 0
2: 0
3: 13
4: 186
963002024_963002030 19 Left 963002024 3:140690791-140690813 CCTCATCACACAGTCTTCCAAGA 0: 1
1: 0
2: 0
3: 15
4: 235
Right 963002030 3:140690833-140690855 AAAGTCTTCGGTAGCTACAGGGG 0: 1
1: 0
2: 0
3: 8
4: 374
963002024_963002033 25 Left 963002024 3:140690791-140690813 CCTCATCACACAGTCTTCCAAGA 0: 1
1: 0
2: 0
3: 15
4: 235
Right 963002033 3:140690839-140690861 TTCGGTAGCTACAGGGGATGGGG 0: 1
1: 0
2: 0
3: 2
4: 85
963002024_963002031 23 Left 963002024 3:140690791-140690813 CCTCATCACACAGTCTTCCAAGA 0: 1
1: 0
2: 0
3: 15
4: 235
Right 963002031 3:140690837-140690859 TCTTCGGTAGCTACAGGGGATGG 0: 1
1: 0
2: 0
3: 4
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963002024 Original CRISPR TCTTGGAAGACTGTGTGATG AGG (reversed) Intronic
903087825 1:20879248-20879270 TCTGGGAAGAATGTGTAGTGAGG + Intronic
905269580 1:36778723-36778745 CCTTGGGAGACTTTGTGATCTGG - Intergenic
905458016 1:38101795-38101817 TCTTAGGAGACAGTGTGATATGG - Intergenic
905922547 1:41729070-41729092 TCCTGGATGGCTGTGTGTTGGGG - Intronic
905923089 1:41732053-41732075 TCTAGGAAGGCTGTGGCATGTGG + Intronic
906436067 1:45797659-45797681 TCTTGGGAGAATTTGTGCTGGGG + Intronic
908097318 1:60752546-60752568 TCTTGGAAGGCTGTGAGACAAGG - Intergenic
909932008 1:81506981-81507003 CCTTGGCAGACTGTGTAATTAGG + Intronic
911014436 1:93317253-93317275 TGTGGGAACACTGTGAGATGTGG - Intergenic
913369729 1:118084559-118084581 TCTTTGAAGACAGTGGGAAGAGG - Intronic
914704663 1:150160843-150160865 CCTTGGAAGTGTGTGAGATGAGG + Intronic
915230346 1:154441269-154441291 TATTGGAAGATGGTGTGGTGGGG + Intronic
915812384 1:158927686-158927708 TCTTGGTAGACTCTCTGAGGAGG - Intergenic
915914880 1:159934852-159934874 TCTGGGAAGACTGTGGGCTGAGG - Intronic
916817582 1:168368599-168368621 GCTTGGGAGACTGGGAGATGGGG + Intergenic
918053679 1:180998950-180998972 GCTTGGAAGACAGTGTGAAATGG - Intronic
918085117 1:181238488-181238510 TCTTGGAAGACTAGGTAAAGGGG - Intergenic
919037160 1:192327771-192327793 TCTTGTAAGACTGTTTTTTGTGG - Intronic
919469571 1:197961436-197961458 TCTGAGAAGACTGTGGGATGGGG + Intergenic
921657096 1:217752772-217752794 TCATGGAAGTCTGTGAGAAGTGG - Intronic
1063387678 10:5626343-5626365 TCTGGGATGACTGTGTGCTGAGG - Intergenic
1063629797 10:7722935-7722957 TCTGTAAAGACTGAGTGATGTGG + Intronic
1063734221 10:8734305-8734327 TCTAGCAAGGCTGTGTGATCAGG + Intergenic
1063986105 10:11504532-11504554 TTTTAGAAGACAGTGTGATTTGG - Intronic
1064011300 10:11738640-11738662 ACTTGGGAGGCTGTGTGAGGAGG - Intergenic
1065109432 10:22425341-22425363 TCTAGGCAGACTGTCTGATGGGG - Intronic
1065630177 10:27671786-27671808 CCTTGGAAGGCGGTGTGTTGTGG - Intergenic
1068977616 10:63027694-63027716 TCATGGACGTCTATGTGATGAGG - Intergenic
1070503415 10:77092460-77092482 TCTTGGAAGTCTATGTGCAGAGG - Intronic
1070991562 10:80737682-80737704 TCCTGGAAGACTGTGACATCAGG + Intergenic
1071314335 10:84378814-84378836 ACTTGGGAGACTGTGGGAGGAGG - Intronic
1071710196 10:88042326-88042348 TCCTGGAAAAGTGTCTGATGGGG - Intergenic
1071714587 10:88082670-88082692 TCTTTGTAGACTGTATGATTTGG - Intergenic
1074225679 10:111481840-111481862 ACTTGGAAAACAGAGTGATGAGG + Intergenic
1074583474 10:114744036-114744058 TCTTGGGAGACCATGAGATGTGG + Intergenic
1075598807 10:123752141-123752163 GCATGAAAGGCTGTGTGATGTGG - Intronic
1075604849 10:123797196-123797218 TCTTGGAAGCCTGTGTCTTTGGG - Intronic
1077187879 11:1243555-1243577 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077188300 11:1245226-1245248 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077188835 11:1247326-1247348 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077189254 11:1248997-1249019 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077972865 11:7213600-7213622 TCTTGGGAGCCTGTGTGAGTGGG - Intergenic
1079005707 11:16789940-16789962 TCCTGCAAGAATGTGTGATGAGG - Intronic
1080016512 11:27512528-27512550 TCTTGGAAGACTGAGGCAGGAGG + Intergenic
1080084623 11:28264486-28264508 TCTGGGAAGACAGTGTAGTGAGG - Intronic
1084350280 11:68592941-68592963 TCAGGGAAGACTGTGTCCTGGGG + Intronic
1084371465 11:68747601-68747623 TGCTGGAAGAATGTGTGATGGGG - Intronic
1084470513 11:69356605-69356627 GCTTGGAAGACTGATTGACGAGG + Intronic
1084672437 11:70615251-70615273 TCCTGGTGGACTCTGTGATGAGG + Intronic
1086428568 11:86713086-86713108 AATTGGAAGAGTGTGGGATGGGG + Intergenic
1086811015 11:91310318-91310340 TCTTAGCAGACTGTCTGATCTGG + Intergenic
1089559659 11:119337458-119337480 GCTGGGAAGACTATGTCATGGGG + Intergenic
1091030176 11:132179633-132179655 TTTTGGAAGACGGTTTGAAGAGG + Intronic
1092920525 12:13227630-13227652 TCTCAGAAGTCTGTGTGATCTGG - Intergenic
1094660274 12:32463641-32463663 TCTTGGAAGCCTGTGAAATAGGG + Intronic
1095463944 12:42470927-42470949 CCTTGGAAGACTGGCTGAGGAGG - Intronic
1098113318 12:67147471-67147493 CCTTGGAAGACTGTGAGCAGAGG - Intergenic
1098589067 12:72188671-72188693 TCTTGAAAGACTGGATGATGTGG - Intronic
1101299744 12:103466920-103466942 TCTGGGAAGACTGGGTGACTTGG - Intronic
1102157344 12:110742217-110742239 TCTCGGAAGGCAGTTTGATGAGG - Intronic
1106588274 13:31075915-31075937 ACTTGGAAGACTGAGTTAGGAGG - Intergenic
1106831345 13:33586709-33586731 TCTTGCAACACACTGTGATGAGG + Intergenic
1107019123 13:35733523-35733545 TGTTTGCAGACTGTCTGATGTGG - Intergenic
1107109727 13:36683881-36683903 TCTGGGGAGACTGTGGGTTGAGG - Intronic
1107495826 13:40924764-40924786 TTTTGGAAAACTGTGTGACACGG + Intergenic
1107882778 13:44847560-44847582 CTTTGGAAGACAGTTTGATGGGG - Intergenic
1107943494 13:45396167-45396189 CCTTGGAAGATAGTTTGATGTGG - Intronic
1108945497 13:56018666-56018688 TCTGGGAAGGCTGTTTGTTGTGG + Intergenic
1110808867 13:79790621-79790643 TCTAGGCAGGCTGTCTGATGTGG + Intergenic
1111748774 13:92300657-92300679 TCTTTTAAGACAGTGTAATGAGG + Intronic
1117241977 14:53843143-53843165 TCTTGGCAGACTGTGTAATACGG - Intergenic
1120274736 14:82357906-82357928 TCTTGGAATCCTGAGGGATGAGG + Intergenic
1121896163 14:97649911-97649933 CCTTGGAAGTCTGTGTCATGTGG + Intergenic
1121906978 14:97755126-97755148 TCTTGGCAGACTGTGTTTTTAGG + Intronic
1121945795 14:98120493-98120515 TCCTGGAACACTGTGTGGAGAGG - Intergenic
1123461954 15:20480735-20480757 TCTTGGAAGACACTGTCATATGG + Intergenic
1123656102 15:22519651-22519673 TCTTGGAAGACACTGTCATATGG - Intergenic
1124272640 15:28296724-28296746 TCTTGGAAGACACTGTCATATGG + Intronic
1124310012 15:28614823-28614845 TCTTGGAAGACACTGTCATATGG - Intergenic
1126357790 15:47814503-47814525 TGTTGAAAGGCAGTGTGATGTGG - Intergenic
1127390294 15:58499814-58499836 TCTAGGAAAACTGTGTCCTGGGG + Intronic
1128433839 15:67626122-67626144 AATTGGAAGAATCTGTGATGTGG + Intronic
1129464243 15:75715017-75715039 GCTTGGAAGACTGTGTTTGGAGG + Intergenic
1129721003 15:77877996-77878018 GCTTGGAAGACTGTGTTTGGAGG - Intergenic
1129936644 15:79456597-79456619 ACTTGGACGACTGCCTGATGGGG - Exonic
1130247620 15:82266582-82266604 TCTTGGAAGACTCTGAGACAAGG - Intronic
1130728731 15:86467684-86467706 CCCTGAAATACTGTGTGATGAGG - Intronic
1131571650 15:93543516-93543538 TCTTAGAAGACTGTCTAGTGTGG - Intergenic
1131634065 15:94211005-94211027 TCTTGGGAGAGTGTGTGTTGAGG + Intergenic
1132777478 16:1603419-1603441 TTTTCAAAGGCTGTGTGATGTGG + Intronic
1134311309 16:13077555-13077577 TCTTAGAAAACTGGGGGATGGGG + Intronic
1134809458 16:17154917-17154939 TCTTGAAAGACAGAGAGATGGGG - Intronic
1136023791 16:27456903-27456925 CCCTGGAAGGCGGTGTGATGGGG + Intergenic
1137365227 16:47854114-47854136 TCTTGGAGGTGTGTGTGCTGGGG - Intergenic
1137498222 16:48987691-48987713 TCTTTGGAGACTGTGTAGTGTGG + Intergenic
1137977783 16:53045735-53045757 CCTTGTAGGACTGTGTGATTGGG - Intergenic
1140125491 16:72114579-72114601 TATGGGTATACTGTGTGATGTGG + Intronic
1140922827 16:79554623-79554645 TCCTGGGAGACTGAGTAATGGGG - Intergenic
1141242231 16:82274672-82274694 TCTTGGATGCCTGGGTGTTGGGG + Intergenic
1142646297 17:1315891-1315913 TCTGGGAAGACTGTGGGGTCTGG - Intergenic
1143480166 17:7223562-7223584 TCTTGGAGATCTGGGTGATGAGG + Intronic
1145813262 17:27777609-27777631 TCTTTGAAGAATGAATGATGAGG - Intronic
1146458865 17:33028102-33028124 TCTGGGAAGACTCTGTTATTTGG - Intronic
1147267533 17:39244003-39244025 TCTTGGAGGTGTGTGTGTTGGGG + Intergenic
1147935945 17:44011208-44011230 TTTTGGAGGACTGTGTGGTCTGG + Exonic
1149676356 17:58466329-58466351 TCTTGGAAGAATCTGTCATTTGG + Intronic
1153361281 18:4199661-4199683 TTTTGGAAAACTATGTGATGGGG + Intronic
1154055594 18:11010428-11010450 TCTTAGAGGATTGTGTGATTAGG - Intronic
1155248302 18:23932403-23932425 TTTTGAAAGACTGTGGTATGCGG - Intronic
1156595961 18:38548035-38548057 GCTGTGAAGACTCTGTGATGGGG + Intergenic
1158850931 18:61495545-61495567 TCTTAGAAGTAGGTGTGATGAGG - Intronic
1161010314 19:1956675-1956697 TCTGGGTAGACTGAGTGTTGGGG + Intronic
1161096109 19:2392035-2392057 TCTTGAAAGACTTCCTGATGGGG - Intronic
1161529901 19:4782079-4782101 TCTTGGGGAACTGTGTGATTTGG + Intergenic
1161960803 19:7522167-7522189 TGTTGGAAGACTCTGGGCTGGGG + Intergenic
1161963671 19:7536041-7536063 TCTTGGGAGGCTGTATGGTGGGG + Intronic
1163133441 19:15291327-15291349 TCTTGGGAGACTGTGGGCTCAGG + Intronic
1163852179 19:19670350-19670372 TCTTGGAAGACTGAGGCAGGAGG - Intronic
1164103689 19:22083837-22083859 TTTTTGAAAACTGAGTGATGTGG + Intronic
927321551 2:21752793-21752815 TCATGGTAGAAAGTGTGATGGGG + Intergenic
927759539 2:25740255-25740277 GCATCGAAGAGTGTGTGATGTGG + Intronic
930107121 2:47649085-47649107 GCTTGGGAGACTGGGTCATGTGG + Intergenic
931546837 2:63397622-63397644 TCATAGAAGGCTGTTTGATGAGG + Intronic
931999165 2:67867937-67867959 TCTAGGAATCCTGTTTGATGTGG - Intergenic
932667223 2:73707828-73707850 TCCTGGATGACTGTGTGTGGCGG + Intergenic
932978111 2:76629329-76629351 TCTGGGAAGCCAGTGTGGTGTGG + Intergenic
936793075 2:116173193-116173215 TCCTTGAAGACTGTTAGATGTGG - Intergenic
937409784 2:121663810-121663832 TCTCGGAAGACTGAGTCAGGAGG + Intergenic
941651651 2:168098780-168098802 TGTTGGAAGAGTGTGTGAGATGG - Intronic
944476426 2:200111485-200111507 ACTTGGAAGACTGAGGGAGGAGG - Intergenic
1169322181 20:4642041-4642063 TCTGGGCAGACTGACTGATGAGG + Intergenic
1170786871 20:19474934-19474956 TTTTGAAAAACTGTTTGATGTGG + Intronic
1170798533 20:19571032-19571054 TCCTGGAATGCTGTGTGGTGTGG + Intronic
1171484110 20:25475349-25475371 TCTTGGAAGAGTTTGAGAAGAGG - Intronic
1172183506 20:33017670-33017692 TCATAGGAGACAGTGTGATGAGG + Intronic
1172904617 20:38359875-38359897 TCCTGGAAGACTGAATGCTGGGG - Intronic
1174562236 20:51439547-51439569 TCTGGGGAGGCTGTGGGATGTGG - Intronic
1175577734 20:60075123-60075145 TCTTTGAAAGCTGTGTGGTGGGG + Intergenic
1176158484 20:63636015-63636037 TCTAGGCAGAGTGTCTGATGTGG + Intergenic
1176738763 21:10577817-10577839 TCTTGCCAGATTGTGTTATGAGG + Intronic
1178106724 21:29327524-29327546 AATTGTAAGACTGTGTGATAGGG + Intronic
1183719850 22:39556512-39556534 TCTTTGGAGAATGTGTGGTGAGG - Intergenic
1184098463 22:42329265-42329287 CCTTGGCAGCCTGTGTGCTGGGG - Intronic
1185129929 22:49033122-49033144 TCTGGGGAGTCTGTGTGCTGCGG + Intergenic
950007287 3:9699441-9699463 GCCTGCAAGACTGTGGGATGTGG + Intronic
950850023 3:16053375-16053397 TGGTGGAAGACTTTGTGATGAGG - Intergenic
951114909 3:18848249-18848271 CCTTGGAAAACTGTGTGTTTGGG - Intergenic
951399121 3:22208889-22208911 TCATGGAAGGCTTTGTAATGAGG + Intronic
952041073 3:29262558-29262580 GCTGGGAAGACTGTGAGATAGGG - Intergenic
953575034 3:44106200-44106222 TCTAGGAGGACTGTGTGAAAAGG - Intergenic
953923356 3:46967268-46967290 CCTTGGATGACTGTGTGTGGAGG - Intronic
953960756 3:47264035-47264057 GCATGGGAGACTGTGTGAGGAGG - Intronic
955249142 3:57261109-57261131 ACTGGGAAGGCTGAGTGATGAGG - Intronic
960243305 3:115371212-115371234 TATTGCAAAACTCTGTGATGAGG - Intergenic
961395854 3:126589402-126589424 TTTTGGAATAAGGTGTGATGTGG + Intronic
962901487 3:139765750-139765772 TCATGGTAGACTGAGTGAAGGGG - Intergenic
963002024 3:140690791-140690813 TCTTGGAAGACTGTGTGATGAGG - Intronic
963513857 3:146283133-146283155 TCTTGAAAGACAATGTGATTGGG + Intergenic
967514003 3:190345610-190345632 TCTAGAAAGACTCTTTGATGAGG + Intronic
969470458 4:7384653-7384675 TCTTGGGAGACAGTGTGTTCTGG + Intronic
969502358 4:7560789-7560811 TCTTGTAAGGCTGGGTAATGAGG + Intronic
970372164 4:15418847-15418869 TCTGGGCAGACTCTGTGCTGAGG - Intronic
971402621 4:26290228-26290250 ACTTGGAAGACTGTGACAGGAGG + Intronic
972080019 4:35138982-35139004 TATTAGAAGACTGTGTGAGTGGG - Intergenic
973626736 4:52779948-52779970 ACTTGGAAGGCTGAGTGAGGAGG + Intergenic
973685421 4:53365332-53365354 GCTGGGAAGCCTGGGTGATGTGG - Exonic
974075819 4:57167265-57167287 AACTGGAAGACTGTGTGATAGGG + Intergenic
974456460 4:62134609-62134631 GCTTGGAAGAGTGTGAGATATGG + Intergenic
979438003 4:120717676-120717698 CCTTGGTAGCCTGTCTGATGGGG - Intronic
983500234 4:168491135-168491157 TCTAGGAAGATTGTGTGAAAAGG - Intronic
987268202 5:16278177-16278199 TCTAGAAAGACTGTGTTATTAGG - Intergenic
989256937 5:39376356-39376378 TCTTGGAGGGCTGTGTAATAAGG - Intronic
990640624 5:57779986-57780008 CCTTTGAAGACAGTGTGCTGAGG - Intergenic
990728159 5:58779491-58779513 ACTTGGAAGACTGTGACAGGAGG - Intronic
992510606 5:77430134-77430156 TCTTCGAAGACTGAGAGGTGAGG + Intronic
992849410 5:80790656-80790678 TCTTGGAAGATGATGTAATGCGG - Intronic
993851431 5:93015095-93015117 TCTTTGAAGACTGAGTCATAGGG - Intergenic
995986605 5:118183742-118183764 GTGTGGAAGACTGAGTGATGGGG - Intergenic
996960201 5:129237641-129237663 TTGTGGAAGACAGTGTGGTGGGG + Intergenic
998681330 5:144470891-144470913 TTTTGGAAGACTGAGTGCAGTGG + Intronic
999433623 5:151544885-151544907 TCTTGGATGATTGTGTAATAGGG + Exonic
999462291 5:151768033-151768055 TCTTGTAAGGCTGGGTGAAGTGG + Intronic
999482154 5:151958611-151958633 ACTTGGAAGACATTGTGTTGTGG + Intergenic
1000280678 5:159779111-159779133 ACTTGGAAGGCTGAGTCATGAGG + Intergenic
1001881312 5:175246622-175246644 TCTTGAGAGGCAGTGTGATGTGG - Intergenic
1003214205 6:4094333-4094355 ACTTGGAAGACTGTGGCAGGAGG + Intronic
1005300639 6:24466738-24466760 TCTTGGAGGACTGGATGATATGG - Exonic
1006109434 6:31735773-31735795 TCAGGGAAGACGGTGTGTTGAGG - Intronic
1006980137 6:38140991-38141013 TGTTATAAGACTGTGTGGTGTGG - Intronic
1008220373 6:48846604-48846626 TCTAGGAAGACAGTGTGAATTGG + Intergenic
1012545012 6:100409265-100409287 TCTTGGTAGACTGTATGTTCTGG + Intronic
1013920474 6:115396727-115396749 TCTGGGGAGACTGGGTGATTTGG - Intergenic
1014736506 6:125100614-125100636 TCCTTGCAGACTCTGTGATGGGG - Intergenic
1014833422 6:126129342-126129364 TGTTGGAACAGTGTCTGATGTGG + Intergenic
1018461138 6:163999596-163999618 CCTTGGGTGACTGTGTGAGGTGG + Intergenic
1018852839 6:167653597-167653619 CCTTGGAAGACCGTCTGTTGGGG - Intergenic
1019456445 7:1130237-1130259 CCTTTGTGGACTGTGTGATGAGG + Intronic
1019576791 7:1741449-1741471 GCTGGGGAGCCTGTGTGATGAGG - Intronic
1020728015 7:11841631-11841653 TCTAGTCAGATTGTGTGATGTGG + Intergenic
1020750630 7:12136791-12136813 ATTTGGAAGAATGTGTAATGGGG - Intergenic
1022441675 7:30438096-30438118 TCCTGGAAGACTGTGTCTTCAGG - Intronic
1024123315 7:46267018-46267040 GCTTGGAAGACCGTCTGAGGGGG - Intergenic
1024274105 7:47663820-47663842 TCTTGCAAGACTGAGACATGAGG - Intergenic
1025983719 7:66429131-66429153 GCCTGGAAGACTGGGTGCTGTGG + Intergenic
1026031474 7:66798227-66798249 GCCTGGAAGACTGGGTGCTGTGG - Intronic
1027193062 7:76009118-76009140 GCTGGGAAGAGGGTGTGATGTGG + Intronic
1027974279 7:85129476-85129498 TCTTATCAGACTGTGAGATGAGG + Intronic
1028017380 7:85733257-85733279 TGTTGGAAGAAAGTGTGCTGAGG + Intergenic
1028800377 7:94957375-94957397 TCTTGGAAGACTGTGTCCTAAGG + Intronic
1029504925 7:100957526-100957548 TCTGGGAGTACTGTGTGAGGGGG - Exonic
1029504933 7:100957577-100957599 TCTGGGAGTACTGTGTGAGGGGG - Exonic
1030444095 7:109626926-109626948 GCTTGGAAGACTGTGGGCTCTGG - Intergenic
1035344925 7:158191676-158191698 TCTTGGGTGGCTCTGTGATGCGG + Intronic
1036673661 8:10811213-10811235 AGTTTGAAGACTGTGTGATTTGG - Intronic
1036803076 8:11807501-11807523 TGTTGTAAGACTGTGGGGTGAGG + Intronic
1038113152 8:24523172-24523194 TCTACGAAGAATGTGTAATGAGG - Intronic
1038444813 8:27595934-27595956 TCTGGGAAGTCTTTGTAATGTGG + Intergenic
1038694221 8:29791672-29791694 TCTTGGAAGTCTATGTGACAAGG - Intergenic
1040919461 8:52600131-52600153 CCTTGCAGGGCTGTGTGATGAGG - Intergenic
1041431919 8:57791675-57791697 ACTTGGAAGGGTGTGTGATGGGG + Intergenic
1042671779 8:71272078-71272100 TTTTGAAAGAAAGTGTGATGAGG + Intronic
1044355514 8:91217917-91217939 TGTTGGAGGTCTGTGTGAAGGGG + Intronic
1047316085 8:123734427-123734449 TCTTTGAACATTGTGTGATTTGG + Intronic
1051231623 9:14961339-14961361 TCTAGGAAGTCTGTGTGAAATGG - Intergenic
1051649368 9:19305679-19305701 TCTGGGAATGCTGTGTGATTTGG + Intronic
1053036136 9:34827936-34827958 TCTTGGAAGACTGTATCAGCAGG - Intergenic
1057890405 9:98865584-98865606 CCTTGGAAGTCTGTGAGATGGGG - Intergenic
1058709633 9:107668010-107668032 CCTTGGAACACAGTGTGAGGCGG - Intergenic
1058866046 9:109163327-109163349 TCACGGCAGACTGTGTGCTGTGG + Intronic
1060669341 9:125455342-125455364 ACTTGGAACACTATCTGATGGGG + Intronic
1060944353 9:127561164-127561186 TCCTGGAGGACGGTGGGATGGGG - Intronic
1185871625 X:3669540-3669562 TCATGGAGGACTCTGTGGTGGGG - Intronic
1186171481 X:6881908-6881930 TTCTGGAAGACTATGTAATGGGG + Intergenic
1187623861 X:21089162-21089184 TCTTGGAGGTCTTTGGGATGAGG + Intergenic
1189318117 X:40070034-40070056 TTTGGGAAGAATGTGTGATCAGG - Intronic
1190488145 X:50950952-50950974 GCTGGGAAGAGTGTGTGGTGGGG + Intergenic
1192397863 X:70801460-70801482 TCCTGGAAGGCAGTGTCATGTGG - Intronic
1192712882 X:73610035-73610057 GCTTGGAAGGGTGTGTGATTGGG - Intronic
1192985456 X:76394291-76394313 TCTTGGGAGAGTGTGTGTCGAGG + Intergenic
1194618814 X:96141941-96141963 TCTTGGAAGACTGGCATATGAGG + Intergenic
1194936318 X:99953615-99953637 TCTTGCAAGCCTGTGTAAAGAGG + Intergenic
1196567232 X:117222452-117222474 TCTCTGAAGCCTGTGTTATGAGG + Intergenic
1197063902 X:122216093-122216115 TCTTGAAAGGCTTTGGGATGGGG + Intergenic
1197256418 X:124268279-124268301 TCTTGGCAGACTCTGTTCTGTGG - Intronic
1197555410 X:127946953-127946975 TCCTGGAAGTGGGTGTGATGTGG + Intergenic
1197760137 X:130022141-130022163 TCTTGGAGGATTGAGTGAGGTGG - Intronic
1198532148 X:137557942-137557964 CCATGGAGGAATGTGTGATGAGG + Intergenic
1201492506 Y:14557564-14557586 CCTTGGAAAACTGTCTGTTGAGG + Intronic
1201679641 Y:16629747-16629769 TTTTGGAAGGCTGTGTCAGGAGG - Intergenic
1201740591 Y:17320187-17320209 TTATTGAAGAATGTGTGATGTGG - Intergenic
1201893731 Y:18971421-18971443 TTTTGGGAGGCTGTGTGGTGGGG + Intergenic