ID: 963010940

View in Genome Browser
Species Human (GRCh38)
Location 3:140769772-140769794
Sequence GAGGAGTGCAGGGATGGTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963010940_963010947 14 Left 963010940 3:140769772-140769794 CCTGCACCATCCCTGCACTCCTC No data
Right 963010947 3:140769809-140769831 GCCCCCATCAACAGCATAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963010940 Original CRISPR GAGGAGTGCAGGGATGGTGC AGG (reversed) Intergenic
No off target data available for this crispr