ID: 963015508

View in Genome Browser
Species Human (GRCh38)
Location 3:140820559-140820581
Sequence ATTGACTGGGTGGTGGGTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963015499_963015508 -7 Left 963015499 3:140820543-140820565 CCTGTGACTATCAGCCATTGACT No data
Right 963015508 3:140820559-140820581 ATTGACTGGGTGGTGGGTTGGGG No data
963015497_963015508 -3 Left 963015497 3:140820539-140820561 CCTCCCTGTGACTATCAGCCATT No data
Right 963015508 3:140820559-140820581 ATTGACTGGGTGGTGGGTTGGGG No data
963015494_963015508 21 Left 963015494 3:140820515-140820537 CCCGCTTTGAGACCAGGTAAATT No data
Right 963015508 3:140820559-140820581 ATTGACTGGGTGGTGGGTTGGGG No data
963015496_963015508 9 Left 963015496 3:140820527-140820549 CCAGGTAAATTACCTCCCTGTGA No data
Right 963015508 3:140820559-140820581 ATTGACTGGGTGGTGGGTTGGGG No data
963015498_963015508 -6 Left 963015498 3:140820542-140820564 CCCTGTGACTATCAGCCATTGAC No data
Right 963015508 3:140820559-140820581 ATTGACTGGGTGGTGGGTTGGGG No data
963015495_963015508 20 Left 963015495 3:140820516-140820538 CCGCTTTGAGACCAGGTAAATTA No data
Right 963015508 3:140820559-140820581 ATTGACTGGGTGGTGGGTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963015508 Original CRISPR ATTGACTGGGTGGTGGGTTG GGG Intergenic