ID: 963020814

View in Genome Browser
Species Human (GRCh38)
Location 3:140871519-140871541
Sequence CCTTCCTTGTTATCTGGAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963020814_963020819 17 Left 963020814 3:140871519-140871541 CCACTTCCAGATAACAAGGAAGG No data
Right 963020819 3:140871559-140871581 AGCACATTTCAGGCTGCAGTAGG No data
963020814_963020820 20 Left 963020814 3:140871519-140871541 CCACTTCCAGATAACAAGGAAGG No data
Right 963020820 3:140871562-140871584 ACATTTCAGGCTGCAGTAGGAGG No data
963020814_963020818 7 Left 963020814 3:140871519-140871541 CCACTTCCAGATAACAAGGAAGG No data
Right 963020818 3:140871549-140871571 AGAGCTTTGCAGCACATTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963020814 Original CRISPR CCTTCCTTGTTATCTGGAAG TGG (reversed) Intergenic
No off target data available for this crispr