ID: 963020818

View in Genome Browser
Species Human (GRCh38)
Location 3:140871549-140871571
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963020816_963020818 1 Left 963020816 3:140871525-140871547 CCAGATAACAAGGAAGGCCAAGA No data
Right 963020818 3:140871549-140871571 AGAGCTTTGCAGCACATTTCAGG No data
963020813_963020818 8 Left 963020813 3:140871518-140871540 CCCACTTCCAGATAACAAGGAAG No data
Right 963020818 3:140871549-140871571 AGAGCTTTGCAGCACATTTCAGG No data
963020814_963020818 7 Left 963020814 3:140871519-140871541 CCACTTCCAGATAACAAGGAAGG No data
Right 963020818 3:140871549-140871571 AGAGCTTTGCAGCACATTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type