ID: 963020819

View in Genome Browser
Species Human (GRCh38)
Location 3:140871559-140871581
Sequence AGCACATTTCAGGCTGCAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963020817_963020819 -6 Left 963020817 3:140871542-140871564 CCAAGAGAGAGCTTTGCAGCACA No data
Right 963020819 3:140871559-140871581 AGCACATTTCAGGCTGCAGTAGG No data
963020813_963020819 18 Left 963020813 3:140871518-140871540 CCCACTTCCAGATAACAAGGAAG No data
Right 963020819 3:140871559-140871581 AGCACATTTCAGGCTGCAGTAGG No data
963020814_963020819 17 Left 963020814 3:140871519-140871541 CCACTTCCAGATAACAAGGAAGG No data
Right 963020819 3:140871559-140871581 AGCACATTTCAGGCTGCAGTAGG No data
963020816_963020819 11 Left 963020816 3:140871525-140871547 CCAGATAACAAGGAAGGCCAAGA No data
Right 963020819 3:140871559-140871581 AGCACATTTCAGGCTGCAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963020819 Original CRISPR AGCACATTTCAGGCTGCAGT AGG Intergenic
No off target data available for this crispr