ID: 963020820

View in Genome Browser
Species Human (GRCh38)
Location 3:140871562-140871584
Sequence ACATTTCAGGCTGCAGTAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963020816_963020820 14 Left 963020816 3:140871525-140871547 CCAGATAACAAGGAAGGCCAAGA No data
Right 963020820 3:140871562-140871584 ACATTTCAGGCTGCAGTAGGAGG No data
963020817_963020820 -3 Left 963020817 3:140871542-140871564 CCAAGAGAGAGCTTTGCAGCACA No data
Right 963020820 3:140871562-140871584 ACATTTCAGGCTGCAGTAGGAGG No data
963020813_963020820 21 Left 963020813 3:140871518-140871540 CCCACTTCCAGATAACAAGGAAG No data
Right 963020820 3:140871562-140871584 ACATTTCAGGCTGCAGTAGGAGG No data
963020814_963020820 20 Left 963020814 3:140871519-140871541 CCACTTCCAGATAACAAGGAAGG No data
Right 963020820 3:140871562-140871584 ACATTTCAGGCTGCAGTAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963020820 Original CRISPR ACATTTCAGGCTGCAGTAGG AGG Intergenic
No off target data available for this crispr