ID: 963023537

View in Genome Browser
Species Human (GRCh38)
Location 3:140896744-140896766
Sequence CCTGCTCTGGTGAAGGTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963023528_963023537 24 Left 963023528 3:140896697-140896719 CCTGTGATGTCATGAATCTTCAG No data
Right 963023537 3:140896744-140896766 CCTGCTCTGGTGAAGGTGGTGGG No data
963023530_963023537 -8 Left 963023530 3:140896729-140896751 CCGTGGATACCAGCACCTGCTCT 0: 74
1: 212
2: 270
3: 263
4: 393
Right 963023537 3:140896744-140896766 CCTGCTCTGGTGAAGGTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963023537 Original CRISPR CCTGCTCTGGTGAAGGTGGT GGG Intergenic
No off target data available for this crispr