ID: 963028461

View in Genome Browser
Species Human (GRCh38)
Location 3:140942419-140942441
Sequence CCCGCGTCTCCTCAGACGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 78}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963028461_963028468 18 Left 963028461 3:140942419-140942441 CCATGCGTCTGAGGAGACGCGGG 0: 1
1: 0
2: 0
3: 2
4: 78
Right 963028468 3:140942460-140942482 CTTGATTACCCGGACGCCGCTGG 0: 1
1: 0
2: 0
3: 0
4: 12
963028461_963028467 8 Left 963028461 3:140942419-140942441 CCATGCGTCTGAGGAGACGCGGG 0: 1
1: 0
2: 0
3: 2
4: 78
Right 963028467 3:140942450-140942472 GGGGTCGGCGCTTGATTACCCGG 0: 1
1: 0
2: 0
3: 1
4: 20
963028461_963028469 24 Left 963028461 3:140942419-140942441 CCATGCGTCTGAGGAGACGCGGG 0: 1
1: 0
2: 0
3: 2
4: 78
Right 963028469 3:140942466-140942488 TACCCGGACGCCGCTGGACCTGG 0: 1
1: 0
2: 0
3: 4
4: 35
963028461_963028466 -7 Left 963028461 3:140942419-140942441 CCATGCGTCTGAGGAGACGCGGG 0: 1
1: 0
2: 0
3: 2
4: 78
Right 963028466 3:140942435-140942457 ACGCGGGCAAGAGCTGGGGTCGG 0: 1
1: 0
2: 0
3: 13
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963028461 Original CRISPR CCCGCGTCTCCTCAGACGCA TGG (reversed) Intronic
905344331 1:37301215-37301237 CCAGCGCCTCCTCAGACCCCAGG + Intergenic
906157724 1:43623743-43623765 TCCCCGTCTCCTCAGGAGCAGGG - Intergenic
918547322 1:185699963-185699985 CCCACCTCTCCTCAGACCCTAGG + Intergenic
922766240 1:228158067-228158089 GCCGCTCCTGCTCAGACGCACGG - Exonic
924817108 1:247452114-247452136 CCAGCGTCTCCACAGAGGTAAGG - Intergenic
1070083124 10:73207888-73207910 CCCACGTCTCCTCTGAGACAAGG - Intronic
1077327239 11:1969140-1969162 CCCCCGTGTCCTGAGAGGCAGGG - Intronic
1080599580 11:33809033-33809055 CTCACGTCTCCTGAAACGCACGG - Intergenic
1202810221 11_KI270721v1_random:24320-24342 CCCCCGTGTCCTGAGAGGCAGGG - Intergenic
1096760456 12:53837190-53837212 CCTGCTTCTCCTCAGACACGAGG - Intergenic
1105000485 12:132687295-132687317 CCCGCCGCTCCTCAGAGACATGG + Exonic
1105809330 13:23980339-23980361 CCCGCGGCTCCTCCGTCGCCCGG - Intronic
1118653691 14:67924877-67924899 CCAGCGTCTCATCAGAGACAAGG + Intronic
1121624018 14:95371576-95371598 GCCGTTTCTCCTCAGCCGCAGGG + Intergenic
1123631014 15:22259296-22259318 CCCGCGGATCCTCGGACCCAGGG - Intergenic
1127455718 15:59154455-59154477 CCCGAGTCTGCCAAGACGCATGG - Intronic
1133404094 16:5509342-5509364 CCCGCTTCTCCTCATTCACAGGG - Intergenic
1137825850 16:51494155-51494177 CCGGCCTCTCCTCTGACACATGG - Intergenic
1141972010 16:87491210-87491232 CCCGCGGATCCTCGGACCCAGGG + Intronic
1149755072 17:59179745-59179767 CCCAGGTCTCCTCAGGCTCAGGG + Intronic
1149755361 17:59181613-59181635 CCCAGGTCTCCTCAGGCTCAGGG + Intronic
1152834185 17:82519241-82519263 GCCGCGTGGCCTCAGACCCAGGG - Intergenic
1156476818 18:37410744-37410766 CCCCCGTCACCGCAGATGCAAGG + Intronic
1161845132 19:6707846-6707868 CCGGTGTCTTCTCCGACGCAGGG - Exonic
1162657171 19:12140022-12140044 CCTGCGTCCCCTCGGCCGCAGGG - Intronic
1166706043 19:44908599-44908621 CCCGCGTCTCCTCCGCCACCGGG - Exonic
927186865 2:20488218-20488240 CCCCTGTCTCCTCACACCCATGG - Intergenic
927508107 2:23627586-23627608 GAGGCGGCTCCTCAGACGCAAGG - Intronic
946366971 2:219254333-219254355 CCCGAGTCTCCTGGGAGGCAGGG - Intronic
947936540 2:234009497-234009519 ACCGCCTCTCCTCTGACCCAGGG - Intronic
1169084884 20:2820615-2820637 CCCCCCTCTCCTGAGACGCAAGG - Intergenic
1173847928 20:46199687-46199709 CCCGCTCCTCCTCGGTCGCAAGG - Intronic
1175424414 20:58854693-58854715 CCCGGGTCTCAGCAGCCGCAGGG - Exonic
1181310732 22:21943468-21943490 CCCGAGTCTCCTCAGCCCCCAGG - Intronic
1181727213 22:24819992-24820014 CCCCCATCTCCACAGACCCAGGG - Intronic
956695870 3:71919051-71919073 CCCCGGACTCCTCAGATGCATGG - Intergenic
962983242 3:140509381-140509403 CCAGCCTCACCTCAGACCCATGG - Intronic
963028461 3:140942419-140942441 CCCGCGTCTCCTCAGACGCATGG - Intronic
980016952 4:127660704-127660726 CCAGCCTTTCCTCAGACCCAAGG - Intronic
997240155 5:132301013-132301035 GCCGGGTTTCCTCACACGCAGGG - Intronic
1006472864 6:34237933-34237955 CCCGCGCCTCTTCAGCCCCAGGG + Intronic
1011845527 6:91559614-91559636 CCCGAGTCTCATCTGAGGCAAGG + Intergenic
1018596141 6:165482853-165482875 CCCACAACTCCTCAGACACACGG - Intronic
1018709175 6:166485692-166485714 CCCCCACCTCCCCAGACGCACGG + Intronic
1018876607 6:167827103-167827125 GCCGCGCCTCCTCAGCCGCGCGG - Exonic
1019057779 6:169235570-169235592 CCCTAGTCTGCACAGACGCAGGG + Intronic
1019258430 7:66220-66242 CCCGAGTCTCCCCAGACCCCTGG - Intergenic
1023824702 7:44001166-44001188 CCCAGGTCTCCTCAGGCTCAGGG - Exonic
1026088252 7:67279918-67279940 CCCAGGTCTCCTCAGGCTCAGGG - Intergenic
1026726003 7:72870409-72870431 CCCAGGTCTCCTCAGGCTCAGGG + Intergenic
1026747835 7:73026731-73026753 CCCAGGTCTCCTCAGGCTCAGGG + Intergenic
1026751485 7:73054870-73054892 CCCAGGTCTCCTCAGGCTCAGGG + Intergenic
1026755134 7:73082984-73083006 CCCAGGTCTCCTCAGGCTCAGGG + Intergenic
1026758784 7:73111018-73111040 CCCAGGTCTCCTCAGGCTCAGGG + Intergenic
1027034041 7:74912025-74912047 CCCAGGTCTCCTCAGGCTCAGGG + Intergenic
1027088622 7:75282468-75282490 CCCAGGTCTCCTCAGGCTCAGGG - Intergenic
1027092265 7:75310396-75310418 CCCAGGTCTCCTCAGGCTCAGGG - Intergenic
1027095908 7:75338363-75338385 CCCAGGTCTCCTCAGGCTCAGGG - Intergenic
1027273954 7:76540224-76540246 CCCAGGTCTCCTCAGGCTCAGGG + Intergenic
1027323433 7:77029329-77029351 CCCAGGTCTCCTCAGGCTCAGGG + Intergenic
1027327399 7:77059276-77059298 CCCAGGTCTCCTCAGGCTCAGGG + Intergenic
1029396007 7:100309074-100309096 CCCAGGTCTCCTCAGGCTCAGGG - Exonic
1029396230 7:100310460-100310482 CCCAGGTCTCCTCAGGCTCAGGG - Exonic
1029396456 7:100311850-100311872 CCCAGGTCTCCTCAGGCTCAGGG - Exonic
1029396680 7:100313240-100313262 CCCAGGTCTCCTCAGGCTCAGGG - Exonic
1029396905 7:100314632-100314654 CCCAGGTCTCCTCAGGCTCAGGG - Exonic
1029707560 7:102283778-102283800 CCCCAGTCTCTTCAGACTCATGG + Intronic
1029719646 7:102354799-102354821 CCCAGGTCTCCTCAGGCTCAGGG + Intergenic
1029752968 7:102554459-102554481 CCCAGGTCTCCTCAGGCTCAGGG - Exonic
1029770919 7:102653551-102653573 CCCAGGTCTCCTCAGGCTCAGGG - Exonic
1034578868 7:152025706-152025728 GCCGCGCCTCCTCAGGCCCAGGG - Intronic
1035106394 7:156445098-156445120 ACCACGTCTCCTCACACCCAGGG + Intergenic
1035133252 7:156675302-156675324 CCCTCGTCTCCAAAGACGGAGGG - Intronic
1048033221 8:130652520-130652542 CCAGGGTGTCCTCAGAGGCAGGG + Intergenic
1048036210 8:130679717-130679739 CCCAAGACTCCTCAGACACAAGG - Intergenic
1049788383 8:144462192-144462214 TCCGCGTCTCCTCGGAGGCCAGG - Intronic
1051818989 9:21142776-21142798 CCAGCGTCTCCTCACACACAAGG + Intergenic
1053123093 9:35560624-35560646 CCAGGGCCTCCTCAGAGGCAGGG - Exonic
1187018727 X:15357484-15357506 CCCTTGTCTCCTCAGTCGAAGGG + Intronic
1190333200 X:49248243-49248265 CGCGCGGCTCTTCAGGCGCAGGG - Exonic
1190760462 X:53433961-53433983 CCCCCTTCTCCTCAGAAGCCTGG - Intronic