ID: 963028760

View in Genome Browser
Species Human (GRCh38)
Location 3:140945547-140945569
Sequence CCTTCTTGAGACCCTTGTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 97}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963028754_963028760 30 Left 963028754 3:140945494-140945516 CCATTTTTCTGCAAATGGATTAG 0: 1
1: 0
2: 1
3: 23
4: 268
Right 963028760 3:140945547-140945569 CCTTCTTGAGACCCTTGTTGTGG 0: 1
1: 0
2: 0
3: 10
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963028760 Original CRISPR CCTTCTTGAGACCCTTGTTG TGG Intronic
901467136 1:9429417-9429439 CCTTCCTGAGAACCCTGTGGTGG + Intergenic
906275003 1:44508765-44508787 TCTTCTTTAGACCCTCGTGGTGG + Intronic
908512036 1:64857410-64857432 CCTTCATGGGACCCATGGTGGGG - Intronic
913091334 1:115478703-115478725 CCATCTTGAGAGCCTGATTGAGG - Intergenic
916246007 1:162688891-162688913 CCTTCCTGAGACCCTTGTCAGGG + Intronic
919895813 1:202009260-202009282 CCTTCTTGAGACCCTGAATGGGG - Exonic
920747632 1:208643935-208643957 CCATCTTCACACCCTTTTTGGGG + Intergenic
923264480 1:232300986-232301008 CCCTCTTGGGACCTTTGATGGGG - Intergenic
1064917868 10:20481823-20481845 TATTCTTGGGACCCTTGGTGCGG + Intergenic
1070658706 10:78289489-78289511 CTGTATTGAGACCCTTTTTGGGG + Intergenic
1070792838 10:79199921-79199943 CCTTCTACACACGCTTGTTGAGG - Intronic
1073836698 10:107452580-107452602 CCTTTTTGAGAACCATGTTTTGG + Intergenic
1078423469 11:11230919-11230941 ACTTCTTGAGAACTTGGTTGGGG + Intergenic
1080845685 11:36024789-36024811 CCTTCTGCAGCCCCATGTTGAGG + Intronic
1084742444 11:71148382-71148404 CCTTCTTAAGAGCCTTGGTCTGG - Intronic
1087142585 11:94779756-94779778 CCATTTTGAGACCCTTGATTTGG + Intronic
1088633460 11:111796629-111796651 CTTTCTTGAGACCCTTCGTCTGG - Intronic
1093092280 12:14935602-14935624 ACTTCCTGAGACACTTGCTGGGG + Intronic
1098763135 12:74450080-74450102 CCTTCAGGAGACTCCTGTTGAGG - Intergenic
1102078908 12:110082187-110082209 ACTTTTGGAGACTCTTGTTGGGG - Intergenic
1103743605 12:123107553-123107575 CCTTCCTCAGTCCCTTGTGGAGG + Intronic
1104399670 12:128465130-128465152 CCTTCTTTAAACCCCTGGTGAGG + Intronic
1125380700 15:39083715-39083737 CCTTCTTCATATTCTTGTTGAGG + Intergenic
1126079724 15:44948087-44948109 CCTTCTCTTGTCCCTTGTTGTGG + Intergenic
1126415726 15:48415860-48415882 CCTTCCTGAGAGCCTAGCTGAGG - Intronic
1127829490 15:62737829-62737851 CCTTCTTGGGAGCCCTGCTGAGG - Intronic
1130996212 15:88905838-88905860 CCTGTTTGAGACCCCTGTGGAGG - Exonic
1131405369 15:92160116-92160138 CCTCCTTGTGACCTTTCTTGAGG - Intronic
1139474776 16:67197720-67197742 CCCTTTTGAGGACCTTGTTGTGG + Intronic
1144161041 17:12558661-12558683 CCTTCTTGAGACTGCTATTGTGG + Intergenic
1144749336 17:17637676-17637698 CCTTCATGAGAGGCTTTTTGTGG - Intergenic
1145909498 17:28534375-28534397 CCTTCTCGAAGCACTTGTTGAGG - Exonic
1146541504 17:33699693-33699715 CCTTCTTTACAGCCTTGTTGAGG - Intronic
1147164501 17:38586220-38586242 CCTCCTTGTCACCCTTGGTGGGG - Intronic
1149368826 17:55972274-55972296 CATAGATGAGACCCTTGTTGGGG - Intergenic
1152785746 17:82247068-82247090 CCTTCCTGAGAGGCATGTTGAGG - Intronic
1155042092 18:22073386-22073408 CCTTCTACAGACCCTTCTTATGG + Intergenic
1157523144 18:48359124-48359146 CCTTCCTGTGCCCTTTGTTGGGG - Intronic
1161751033 19:6096872-6096894 CCATCTTAAGGCCATTGTTGAGG + Intronic
1162382708 19:10340847-10340869 CCTTGTTGAGAGCCTTGATGGGG + Intergenic
1162401223 19:10447794-10447816 CCTTATCGTGACACTTGTTGAGG + Intronic
928222020 2:29411595-29411617 ACTTTTTGAGGACCTTGTTGAGG + Intronic
929864315 2:45705297-45705319 CCTGCTTGAAACTCTAGTTGCGG + Intronic
934783566 2:96988485-96988507 CCTTGTTGCTACCCTCGTTGGGG - Intronic
942832701 2:180255633-180255655 GCTTCTTAAGCCCCTTGTTAGGG - Intergenic
942898337 2:181085092-181085114 CCTGCTTGAGACCCTGGGAGAGG - Intergenic
945408155 2:209476166-209476188 CCTTCTCGAGACCATGATTGTGG + Intronic
945640471 2:212421322-212421344 CCTTCTGGAAACCCTTTTTAGGG + Intronic
946622909 2:221577671-221577693 CCTTCTTGGGCCCCTGGTGGTGG - Intergenic
948774247 2:240273967-240273989 CCTGCCTGTGACCCTTGGTGGGG - Intergenic
1170536248 20:17343861-17343883 CCTTCTAGAGGCTCTTGTAGGGG - Intronic
1171521926 20:25782827-25782849 CCTTCCTGGGGCCTTTGTTGAGG + Intronic
1171554899 20:26073056-26073078 CCTTCCTGGGGCCTTTGTTGAGG - Intergenic
1178014638 21:28329759-28329781 CCTCCTGGATATCCTTGTTGCGG - Intergenic
1183368105 22:37417806-37417828 CCTTTCTGAGACCCAGGTTGGGG - Exonic
1184550950 22:45203859-45203881 CCTTCTTGAGCGCCTCGTAGCGG + Exonic
949761222 3:7472945-7472967 CCTTTTTGAGATACTTTTTGAGG - Intronic
949852268 3:8431109-8431131 CCTTCTGGAGACTCTAGTTGAGG - Intergenic
950005807 3:9690222-9690244 CCATCTTGAGACCCTAGCTCAGG - Intronic
952279696 3:31911087-31911109 CCTGCTTCAGACCCTGTTTGAGG + Intronic
960595581 3:119404984-119405006 CCTTCTAGAAACGCTTGTTAAGG + Intronic
960979051 3:123204549-123204571 TCTTCTTCAGAACCTTGTAGGGG - Intronic
963028760 3:140945547-140945569 CCTTCTTGAGACCCTTGTTGTGG + Intronic
963065239 3:141258425-141258447 TCTTCTTGCCACCCTTCTTGTGG - Intronic
963972623 3:151446378-151446400 CCTTCTTGAAAACCTTGTAATGG + Exonic
966749335 3:183306906-183306928 CCGTACTGAGACCCTTGCTGAGG - Intronic
969306598 4:6329410-6329432 GCTCTTTGAGACCCTTCTTGTGG - Intronic
974264635 4:59569081-59569103 CATTCTTTAGAACTTTGTTGTGG + Intergenic
975614625 4:76234304-76234326 GCTTCTTGAGCCCCATGTTGGGG + Intronic
983775805 4:171605773-171605795 CCTTCTTTAGACTATTATTGAGG + Intergenic
986779486 5:11051139-11051161 CCTTTTTGAGACCCTTGAGAAGG - Intronic
998524088 5:142826659-142826681 CCTTCTTGAGACCCATGAGGTGG + Intronic
999969321 5:156843340-156843362 CCTTCTTGAAACCCTTCTTTTGG - Intergenic
1000706053 5:164513362-164513384 CCTTCTTGAGAAGTGTGTTGTGG + Intergenic
1004097560 6:12573427-12573449 GCTTCTTGAGATCCAGGTTGAGG + Intergenic
1005514256 6:26538909-26538931 CCTTCGAGAAACCCTCGTTGAGG + Intronic
1006214122 6:32424299-32424321 CCTGCTTGAGGCTCTTCTTGAGG - Intergenic
1013651919 6:112203655-112203677 ACTTCTTGAATCCCTTGCTGGGG - Intronic
1016030834 6:139336194-139336216 CTATCTTGAGACCCTTGTCTGGG + Intergenic
1020215527 7:6187198-6187220 CTTCCTTGAGCCCGTTGTTGCGG - Intronic
1023010203 7:35919058-35919080 CGTTCATGTCACCCTTGTTGAGG - Intergenic
1024080620 7:45852521-45852543 CGTTCATGTCACCCTTGTTGAGG + Intergenic
1024172530 7:46805070-46805092 CCTTCGTGGGCCCCTTGGTGGGG + Intergenic
1025123836 7:56329160-56329182 CGTTCATGTCACCCTTGTTGAGG - Intergenic
1028694979 7:93698741-93698763 CCTGCTTTATACCCTTGTTGAGG + Intronic
1029404173 7:100364193-100364215 TCATCTTGGCACCCTTGTTGAGG - Intronic
1032054635 7:128674629-128674651 ACTTCTTGGAGCCCTTGTTGAGG - Intronic
1033964630 7:146959804-146959826 CCTTCTTGAAACCTTTGCTTTGG - Intronic
1034348124 7:150399292-150399314 CCTTCTCTAGAGCCATGTTGGGG - Intronic
1037192784 8:16147654-16147676 CCTTCTTCAGACTCTTGTAGAGG + Intronic
1040067685 8:43161486-43161508 CCTTTCTGAGGCTCTTGTTGAGG + Exonic
1043419457 8:80084070-80084092 CCTACTTGAGACCCAGGTGGAGG + Intronic
1047922626 8:129651205-129651227 CTTTCTTGAGACCCCTGCTCGGG - Intergenic
1048577689 8:135706052-135706074 CCTTGATGAAACCCTTGCTGAGG - Intergenic
1049004060 8:139843751-139843773 CCTTCTGGAGGCCCTTGAGGAGG - Intronic
1049285232 8:141771280-141771302 TCTTCTTGAGAGGCTTGTTCAGG + Intergenic
1050106983 9:2175801-2175823 CCTTTTTTAAATCCTTGTTGAGG + Intronic
1055691403 9:78835226-78835248 CCTACGTGAGACCCTTTTGGTGG - Intergenic
1061971599 9:134048295-134048317 CCTTCTTGGGAGGCTTGATGGGG + Exonic
1062206134 9:135338479-135338501 CCTTCTTGTGGCCTTTGCTGTGG - Intergenic
1186150561 X:6670358-6670380 CCTCTTTGAGACTCTTGTTTTGG + Intergenic
1188247487 X:27853596-27853618 TCTTCCTGAGACCCTTGAGGTGG - Intergenic
1190327781 X:49217481-49217503 CCATCTTGAGACTCCTGTAGAGG - Intronic
1192679550 X:73237685-73237707 CCTTCTCTAGACACTTGTTCAGG + Intergenic
1194070134 X:89313355-89313377 CTCTGGTGAGACCCTTGTTGTGG + Intergenic
1198626340 X:138579967-138579989 CTTTCCTGAGACCCATGCTGAGG + Intergenic
1199244358 X:145585479-145585501 AATTCTACAGACCCTTGTTGTGG - Intergenic
1200724370 Y:6648981-6649003 CTCTGGTGAGACCCTTGTTGTGG + Intergenic