ID: 963030127

View in Genome Browser
Species Human (GRCh38)
Location 3:140962144-140962166
Sequence CTTGATGCCAAGTTGGGAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 238
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 212}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963030127 Original CRISPR CTTGATGCCAAGTTGGGAAG AGG (reversed) Intronic
901455406 1:9360245-9360267 CTGGATGCCAAGTGAGGAAGGGG + Intronic
902738462 1:18417231-18417253 CTTCATGCCATGATGGAAAGGGG - Intergenic
903046075 1:20565282-20565304 TTAGAGGCCAAGTTAGGAAGTGG + Intergenic
903646439 1:24898889-24898911 CTTGCTGGCAAGGTGGGAGGGGG + Intergenic
905352300 1:37356246-37356268 CCTGAGGTCAGGTTGGGAAGCGG - Intergenic
905773919 1:40655647-40655669 CTTAATGCAAAATTGGGAAGTGG - Intronic
905977881 1:42192259-42192281 GTTTATGCCAAATAGGGAAGGGG + Intronic
908048704 1:60203409-60203431 CTTGAGTACAAGATGGGAAGGGG + Intergenic
909014209 1:70365680-70365702 CTTGAGGCCATGATGAGAAGTGG + Intronic
909443254 1:75721156-75721178 CTTCAGGCCATGATGGGAAGTGG - Intergenic
910927368 1:92410868-92410890 CTTCCTGCCAAGGTGGGAGGGGG - Intergenic
912200627 1:107453662-107453684 GTGGATGCCATGTAGGGAAGTGG + Intronic
912284865 1:108358457-108358479 CTTGTTGTCAGGTGGGGAAGGGG - Intergenic
912692559 1:111815389-111815411 ATGGAGGCCTAGTTGGGAAGAGG - Intronic
913262532 1:117012525-117012547 CTGCATTCCAAGTTGGGAAAGGG - Intronic
915074261 1:153295874-153295896 GTTCAGGCCATGTTGGGAAGTGG + Intergenic
916390316 1:164323243-164323265 CTTGAGGAGAAGTTGGAAAGGGG + Intergenic
919422256 1:197384398-197384420 ATTGATGCCAGGTTGGAAAGTGG - Intronic
919493679 1:198237348-198237370 TTTGATGCCAAGTAGGCAAATGG - Intronic
920944446 1:210515332-210515354 CTTACTCCCAAGCTGGGAAGAGG - Intronic
921714242 1:218401826-218401848 CTTGATGCCCAGTCGGGACGCGG - Intronic
922202853 1:223421182-223421204 CATGGTGCCAAGTTGATAAGCGG - Intergenic
922216317 1:223522978-223523000 CTTGCAGCCAAGAAGGGAAGGGG + Intergenic
923849670 1:237780165-237780187 GTTGAGGCCAAGTTGAGAAGAGG + Intronic
923913401 1:238475362-238475384 CTAGATACAAAGATGGGAAGAGG + Intergenic
924769510 1:247066653-247066675 CTTCAGGCCACGATGGGAAGAGG + Intronic
1067663812 10:48256487-48256509 CTTGATGGAGAGTTGGGGAGGGG - Intronic
1070017283 10:72546023-72546045 GTTCAGGCCATGTTGGGAAGGGG - Intronic
1070602092 10:77873164-77873186 CTTGAGGCCAAGTTTAGACGTGG + Intronic
1073499207 10:103920661-103920683 GTTGAGGACAAATTGGGAAGAGG - Intergenic
1073583317 10:104686688-104686710 TTTGATGACAAGGAGGGAAGAGG - Intronic
1074561802 10:114541727-114541749 CCTGAAGCCAATTTGAGAAGAGG + Intronic
1075199913 10:120394049-120394071 CTTGATGCCAGGATGGACAGTGG + Intergenic
1075559319 10:123456941-123456963 CTAAATGCCAAGTTGGGAGGTGG + Intergenic
1081426369 11:42930536-42930558 TTTGATGCCCAGAAGGGAAGGGG + Intergenic
1085496278 11:76972881-76972903 ATTGTTGCCACTTTGGGAAGGGG - Intronic
1086180247 11:83942594-83942616 TTTGATGCCAATTTTGTAAGAGG + Intronic
1086490029 11:87349911-87349933 GTGGATGCCAAGTTGACAAGGGG + Intergenic
1086647126 11:89236931-89236953 CTGAATGCCAAGTTGGGAAATGG - Intronic
1086782318 11:90922584-90922606 CTTGATGGCATAGTGGGAAGGGG - Intergenic
1088790157 11:113217809-113217831 CATGGTGGCAATTTGGGAAGAGG + Intronic
1092227426 12:6756954-6756976 CTTGAACCCAAGCTGGGAGGCGG - Intronic
1092833158 12:12464473-12464495 CCTGATGCAAGGTCGGGAAGGGG + Intronic
1093567425 12:20624546-20624568 CTTGATGGCAAGAATGGAAGGGG - Intronic
1095913128 12:47448755-47448777 GTAGATGCTAAGTTGGGAATAGG - Intergenic
1097250680 12:57630968-57630990 CTTGGTGCCAGGTAGGGAGGAGG - Exonic
1097931344 12:65190297-65190319 CTTCAGGCCATGATGGGAAGTGG + Intronic
1098340752 12:69448521-69448543 GTAGATGCCAAGTTGGCAACTGG + Intergenic
1098965427 12:76783040-76783062 GTTGAGGCCTAGTTGAGAAGAGG + Intronic
1100033032 12:90216319-90216341 ATGGATGCCAAGTTGACAAGGGG - Intergenic
1100687031 12:96997609-96997631 TTTGGGGCCAAGTTTGGAAGTGG + Intergenic
1101125870 12:101633269-101633291 CTTGTTGCAAAGAGGGGAAGGGG + Intronic
1105428898 13:20319202-20319224 CTGGATGCCAAGTTGACAAGGGG + Intergenic
1106054023 13:26221781-26221803 CTTGAGGCTCGGTTGGGAAGAGG - Intronic
1106340656 13:28823596-28823618 GTTGAGGCCCAGTTGAGAAGAGG - Intronic
1109955359 13:69558482-69558504 ATTGGTGTCAAGTTGGCAAGGGG + Intergenic
1112421335 13:99252114-99252136 CTGGATGACCAGTTGGGAAGTGG - Intronic
1116222973 14:42112122-42112144 TCTGAAACCAAGTTGGGAAGAGG - Intergenic
1117918690 14:60705278-60705300 CTTGATACCCAGTAGGGAAGTGG + Intergenic
1119530803 14:75359795-75359817 CTGGAGGCCAAATTGTGAAGAGG + Intergenic
1121980917 14:98452822-98452844 CAGGATTCCAAGTTGGGCAGAGG + Intergenic
1123013949 14:105364545-105364567 CTTGCTGCGATGTTGGCAAGAGG + Intronic
1124378403 15:29143447-29143469 CTTGGGGGCAAATTGGGAAGAGG + Intronic
1125416308 15:39457142-39457164 CTTGAGGCTCAGCTGGGAAGAGG + Intergenic
1126309411 15:47298818-47298840 CTTTTTGCCAATTTGTGAAGAGG + Intronic
1126580807 15:50240989-50241011 GTTGAGGCCTAGTTGAGAAGGGG - Intergenic
1128290710 15:66476426-66476448 CATTATCCCAAGTTGGGAAGGGG + Intronic
1129957826 15:79655352-79655374 CCTAATGGCAAGCTGGGAAGAGG - Intergenic
1130642152 15:85687512-85687534 CTTGAAGCCAAGTCTGAAAGAGG - Intronic
1131540142 15:93268923-93268945 CTTGATACCAAGGTGGCTAGAGG + Intergenic
1133387359 16:5380526-5380548 CTTCATGCCAAGCTGCGAATAGG + Intergenic
1134775471 16:16849607-16849629 CTTTATCCCTAGTTGGGCAGGGG - Intergenic
1135626294 16:23997869-23997891 ATGGATGCCAAGTTGAGAAAGGG + Intronic
1138182913 16:54954910-54954932 TTTAATGCCAGGTTGGGAAGGGG - Intergenic
1138339148 16:56277252-56277274 CTGGAGGCCAAGTTGGGAAGTGG + Intronic
1140531377 16:75669644-75669666 CTGGATTTCAACTTGGGAAGGGG - Intronic
1140966084 16:79967548-79967570 CTGCATTCCAATTTGGGAAGTGG - Intergenic
1141659593 16:85434936-85434958 CTTGCTGCCAGTTTGGGGAGGGG - Intergenic
1141731168 16:85824290-85824312 CTTGAGGCCAACTTGGTCAGGGG + Intergenic
1142407735 16:89900484-89900506 CTTTATGCTGAGTTAGGAAGAGG + Intronic
1142472138 17:170467-170489 CTTGCTGCCAGGCTGGGAGGAGG + Intronic
1142854422 17:2721957-2721979 CTGGATGCCCAGGAGGGAAGGGG + Intergenic
1146929031 17:36764933-36764955 CTTGCCCCCAAGTTGGGTAGGGG + Intergenic
1148713851 17:49701480-49701502 CTTGATGCCAAGTTTGGGAAAGG - Exonic
1148809713 17:50282600-50282622 CTGAATCCAAAGTTGGGAAGGGG + Intergenic
1150454022 17:65292749-65292771 CAGGATGCCAAGTGAGGAAGAGG - Intergenic
1151190641 17:72395400-72395422 CTCTATGCCCAGATGGGAAGAGG - Intergenic
1151625806 17:75274810-75274832 CTTCAGGACAAGTTGGTAAGTGG + Intronic
1153126419 18:1797382-1797404 CTTGATGCCATGTTGGCACTGGG + Intergenic
1153625723 18:7020695-7020717 CTTGATGACAGGTTGGAAGGTGG - Intronic
1156622434 18:38868576-38868598 CTAGGTGCCAAGGTCGGAAGTGG - Intergenic
1157805845 18:50657043-50657065 CTTGAGGCCACGTGGGGAGGTGG - Intronic
1159786294 18:72718441-72718463 CTTCAGGCCATGATGGGAAGTGG + Intergenic
1165019127 19:32908698-32908720 TATGATGCCAACATGGGAAGGGG - Intronic
1166139930 19:40800187-40800209 CCTGAGGCCAAGTCGGGGAGAGG - Exonic
1166714940 19:44960970-44960992 CTGAATGCCAGGTTTGGAAGGGG - Intronic
925356816 2:3247462-3247484 CTTGCTGTGAAGTTGGGATGTGG - Intronic
926584046 2:14665716-14665738 CAAGAAGCCAAGTTGGAAAGAGG + Intergenic
930023845 2:47017804-47017826 CTACATGACAAATTGGGAAGTGG - Intronic
931451850 2:62374371-62374393 CTTGAAGCAAAGTCAGGAAGTGG + Intergenic
933988352 2:87613009-87613031 TTTGGTGCCAAGTTGGGATCAGG - Intergenic
936305489 2:111337799-111337821 TTTGGTGCCAAGTTGGGATCAGG + Intergenic
936691546 2:114895621-114895643 TGAGATGGCAAGTTGGGAAGTGG - Intronic
937161452 2:119766209-119766231 TTTGTTGCCAAGTTGGGAAAAGG + Intronic
938370591 2:130765970-130765992 ATGGATGCCAAGTTGACAAGGGG - Exonic
938569718 2:132551537-132551559 CTTGATGCAAGGATGGGCAGTGG + Intronic
939720659 2:145646338-145646360 ATGGATGCCAAGTTGGCAAGGGG - Intergenic
942625254 2:177893535-177893557 CTTACTGTCAAGTTGGGGAGGGG + Intronic
943309247 2:186306539-186306561 GTTGAGGCCATGATGGGAAGGGG + Intergenic
944226577 2:197354771-197354793 CTTCGTGCCATGTTGGGAACTGG - Intergenic
944455255 2:199886985-199887007 CCTTGTGCCAAGATGGGAAGAGG - Intergenic
946653317 2:221917604-221917626 CTTGATTCCAAGTTGTGGTGGGG + Intergenic
948254330 2:236554949-236554971 CTGAATGTCAAGTTTGGAAGGGG + Intergenic
1172880634 20:38197666-38197688 GATGATGCCAAGATGGGGAGGGG - Intergenic
1175166570 20:57048453-57048475 CTGGCTGCCAAGTTGAGAATGGG + Intergenic
1178570601 21:33732343-33732365 GTTCAAGCCAAGATGGGAAGAGG - Intronic
1179709027 21:43201388-43201410 GTTGAGGCCTAGTTGAGAAGGGG + Intergenic
1179977618 21:44878274-44878296 CTTAATACCAAATAGGGAAGGGG + Intergenic
1181753995 22:25009882-25009904 CTTGATTAAAAGTAGGGAAGGGG - Intronic
1182359895 22:29740291-29740313 CTTGGTGCCAAGTGGGGACTGGG + Intronic
1182664230 22:31945204-31945226 CTTTATTCCAAGTTGGGGAACGG - Intronic
1184203642 22:42986454-42986476 CTGGTTGCCATGCTGGGAAGGGG - Intronic
1184241398 22:43212871-43212893 CTTGCTGCTGAGCTGGGAAGGGG + Intronic
949352527 3:3139041-3139063 CTTGAAACCAAGTAGGGAAAGGG + Intronic
949615029 3:5744241-5744263 ATAGGTGCCAAGTTGAGAAGGGG + Intergenic
950799560 3:15539194-15539216 CTGGATGCCATGTTGGGCATGGG - Intergenic
952527023 3:34221566-34221588 CTTGGTGCCATGTTGAGGAGAGG + Intergenic
953112027 3:39952055-39952077 CTTGGGGCCAGGGTGGGAAGAGG - Intronic
953530535 3:43736093-43736115 CTTGATGGTAAGTTGGGAGATGG + Intergenic
954645378 3:52128252-52128274 CCAGAGGCCAAGTTGGGAAAAGG + Intronic
954763820 3:52896981-52897003 CATGATTCCAGGCTGGGAAGTGG + Intronic
958667293 3:97157974-97157996 ATGGATGCCAAGTTGACAAGGGG - Intronic
959213036 3:103413380-103413402 ATGGATGCCAAGTTGGCAAGAGG - Intergenic
961329494 3:126130339-126130361 CTTGCTGCCTAGAGGGGAAGGGG - Intronic
961365666 3:126397900-126397922 CTGGAGGCCAAGTAGGGAAAGGG + Intronic
961521327 3:127468905-127468927 ATTGATGCCATGTTGGGCAGGGG + Intergenic
962290228 3:134129631-134129653 GTGGATGCCTAGTTGAGAAGAGG - Intronic
963030127 3:140962144-140962166 CTTGATGCCAAGTTGGGAAGAGG - Intronic
967946719 3:194809937-194809959 CAAGATGGGAAGTTGGGAAGAGG - Intergenic
969535817 4:7755560-7755582 CCTGATGCTGAGCTGGGAAGCGG - Intergenic
974542637 4:63257945-63257967 GTTGAGGCCTAGTTGAGAAGAGG - Intergenic
975109095 4:70603881-70603903 CATGATGCCAAGTCTGGCAGGGG - Exonic
976259030 4:83128356-83128378 GTTGATGCCAATATGGCAAGTGG + Intronic
978487788 4:109275845-109275867 CCTGATGCCAAAATGGCAAGAGG + Intronic
979505145 4:121486424-121486446 CTTGAAGCTAACTTGGGGAGAGG - Intergenic
980587581 4:134837201-134837223 TTTGATACCAATTTTGGAAGCGG + Intergenic
982055047 4:151540310-151540332 CCTGCAGCCAACTTGGGAAGAGG + Intronic
982125420 4:152179997-152180019 CTTTCTGCCAAGGTGGAAAGTGG - Intergenic
982927141 4:161352245-161352267 AGTGATTCCTAGTTGGGAAGTGG + Intergenic
983053149 4:163071691-163071713 GTTGAGGCCTAGTTGGGAAGAGG - Intergenic
983881688 4:172940319-172940341 AATGATTCCTAGTTGGGAAGTGG - Intronic
984353822 4:178632133-178632155 AATGATGCAAAATTGGGAAGAGG - Intergenic
984865167 4:184274886-184274908 GTTGAGGCCTAGTTGAGAAGAGG - Intergenic
985225911 4:187761789-187761811 ATAGATGCCAAGTTGACAAGGGG - Intergenic
988815257 5:34828191-34828213 CTTGCTGGAAAGATGGGAAGTGG + Intronic
989252168 5:39330035-39330057 TTTGATGCCAACTGGGGCAGTGG - Intronic
989278185 5:39612334-39612356 ATTGAGGCCTAGTTGAGAAGAGG - Intergenic
989439042 5:41448366-41448388 CTAGATGCCAGTTTGGGATGTGG - Intronic
990306131 5:54495571-54495593 CTTGATGCAAAGGTATGAAGAGG - Intergenic
990405279 5:55484048-55484070 GTTGAGGCCTAGTTGAGAAGAGG - Intronic
991255361 5:64607786-64607808 GTTCAGGCCATGTTGGGAAGAGG - Intronic
992466912 5:77015267-77015289 GTTGAGGCCTAGTTGAGAAGAGG - Intergenic
994916970 5:105993492-105993514 CTTGCTGTCATGTTAGGAAGTGG - Intergenic
995060962 5:107811450-107811472 CCTGATGGCAAGTTGGAAATGGG + Intergenic
995111560 5:108434626-108434648 ATGGGTGCCAAGTTGAGAAGAGG + Intergenic
996184936 5:120464095-120464117 CTTGATGCCAAGGTGGCATCTGG + Intergenic
996537332 5:124592108-124592130 CCTGATGCCCATTTGGGAATGGG - Intergenic
997040105 5:130242797-130242819 CTGGATGCCAAATTGACAAGGGG + Intergenic
999073407 5:148771838-148771860 CTGGAAGCCAAGGTGGGAAAGGG - Intergenic
999146332 5:149398122-149398144 CTTGGTGCCAAGTTGACAAGGGG - Intronic
1000657117 5:163892942-163892964 GTTCAGGCCATGTTGGGAAGCGG + Intergenic
1003741470 6:8945626-8945648 TTTGATGCAAAGTTTGGAAATGG - Intergenic
1004450727 6:15743280-15743302 GTTGAGGACTAGTTGGGAAGAGG - Intergenic
1004772143 6:18795953-18795975 TTTGATCCCAATGTGGGAAGTGG - Intergenic
1007585978 6:42989741-42989763 CATGATGGCTAGTTGGGTAGGGG + Intronic
1007861596 6:44915522-44915544 GTTCATGCCATGATGGGAAGTGG + Intronic
1009770081 6:68134516-68134538 ATGGATGCCAAGTTGACAAGGGG - Intergenic
1010444537 6:75935549-75935571 CTTGGTGGTAAGTGGGGAAGGGG - Intronic
1012700852 6:102454985-102455007 TTTGATGCAAAATTGTGAAGTGG + Intergenic
1015231242 6:130917301-130917323 CCTGAAGCCTAATTGGGAAGAGG - Intronic
1015588355 6:134799271-134799293 TTTGCTGCAAAGTTGGAAAGAGG - Intergenic
1016388686 6:143553679-143553701 GTTGAGGCCTAGTTGAGAAGAGG + Intronic
1018734174 6:166675134-166675156 CTTGCTGGCAAGCTGGGCAGAGG - Intronic
1022871593 7:34486017-34486039 CTTGATGCCAAGTGTAGAATAGG - Intergenic
1023822722 7:43988855-43988877 CTTGGGGCCATGTTGGGAGGTGG - Intergenic
1026056593 7:66989828-66989850 CTGGGTGCCAAGTTGATAAGGGG - Intronic
1026401635 7:70020185-70020207 CTTGGTGTCAATTTGGGGAGAGG - Intronic
1026721503 7:72835233-72835255 CTGGGTGCCAAGTTGATAAGGGG + Intergenic
1026848670 7:73711661-73711683 CAGGCTGCCAGGTTGGGAAGTGG + Intronic
1028184962 7:87772019-87772041 CTGAATGCAAAATTGGGAAGAGG + Intronic
1029750987 7:102542270-102542292 CTTGGGGCCATGTTGGGAGGCGG - Intronic
1030354578 7:108527835-108527857 GATGAGGCCTAGTTGGGAAGAGG + Intronic
1032857478 7:135847152-135847174 ATGGATGCCAAGTTGACAAGGGG - Intergenic
1034759679 7:153659488-153659510 CTGGATTCCAAGATGGGAACAGG + Intergenic
1034941403 7:155232652-155232674 CCTGCTGCAAAGCTGGGAAGAGG + Intergenic
1037344383 8:17882493-17882515 CTTGATGCCCAGTGGGTAAGCGG + Intronic
1039790613 8:40872766-40872788 GTTGATGCCAATTGGGGTAGGGG + Intronic
1040103842 8:43528065-43528087 CTGGATGCCAAGGTGAGGAGAGG + Intergenic
1040413451 8:47177918-47177940 CATGGTGCCAAGTTTTGAAGAGG - Intergenic
1041512011 8:58662996-58663018 GTTGAGGCCTAGTTGAGAAGTGG - Intergenic
1044805900 8:96007738-96007760 CTTTATTCTCAGTTGGGAAGAGG + Intergenic
1045509736 8:102805565-102805587 AATGATGCCAACCTGGGAAGGGG - Intergenic
1046545728 8:115648156-115648178 GAGGAAGCCAAGTTGGGAAGTGG + Intronic
1048102481 8:131368730-131368752 CTTGAGTCCAAGATTGGAAGTGG + Intergenic
1050461529 9:5881473-5881495 TTTGATGCTAAGCAGGGAAGAGG + Intergenic
1051734608 9:20185800-20185822 CTGGAAGCCAGGTAGGGAAGGGG + Intergenic
1052820165 9:33132202-33132224 CCTGATGCTAAGTTGTGAAGTGG + Intronic
1053323410 9:37120343-37120365 CTTCAAGAGAAGTTGGGAAGGGG + Intergenic
1053611086 9:39713710-39713732 ATGGATGCCAAGTTGACAAGAGG + Intergenic
1053869128 9:42471761-42471783 ATGGATGCCAAGTTGACAAGAGG + Intergenic
1054087168 9:60757448-60757470 ATGGATGCCAAGTTGACAAGAGG - Intergenic
1054242434 9:62628685-62628707 ATGGATGCCAAGTTGACAAGAGG - Intergenic
1054556561 9:66663203-66663225 ATGGATGCCAAGTTGACAAGAGG - Intergenic
1056018369 9:82416243-82416265 GTTGAGGCCTAGTTGGGAAGAGG + Intergenic
1057486479 9:95488778-95488800 GGTGATGCCATGTTGGGTAGTGG + Intronic
1058301076 9:103373668-103373690 GTTGAGGCCATGATGGGAAGGGG + Intergenic
1059182127 9:112226241-112226263 CTTGAATCCAAGTGGGGCAGTGG - Intronic
1059662034 9:116411373-116411395 TTTGAGGCCAAGTGGGGAATTGG + Intergenic
1060695163 9:125703109-125703131 CTTGTTGCCATGTGAGGAAGTGG - Intronic
1060729136 9:126026099-126026121 CTTGAGGCCATGTGGAGAAGAGG + Intergenic
1061912276 9:133731542-133731564 GTGGATGCCCAGTTGGGGAGGGG - Intronic
1062221731 9:135419682-135419704 CTTGATGCCCAGTAGGGAGCCGG - Intergenic
1062547240 9:137069342-137069364 CCTGTTGCCAAGATGGGCAGGGG - Intronic
1185652004 X:1654875-1654897 GTTCATGCCATGTTGGGAAGTGG - Intergenic
1186375340 X:8992543-8992565 GCTGGTGCCAAGTGGGGAAGGGG + Intergenic
1186693622 X:12005783-12005805 GCTGGTGCCAAGTGGGGAAGGGG + Intergenic
1188791784 X:34414328-34414350 CCTGATGACAAGCAGGGAAGGGG - Intergenic
1189575469 X:42348555-42348577 CTTGGTGCCAATTTGGGATCTGG + Intergenic
1190025290 X:46916645-46916667 ATTGTTGCAAAGTTGGGGAGTGG - Intronic
1190408239 X:50109145-50109167 CTTCAGGCCATGATGGGAAGGGG + Intergenic
1190866939 X:54392619-54392641 GTTGAGGCCATGATGGGAAGTGG + Intergenic
1191953316 X:66617784-66617806 CTTGGTGCCAAATTGAGCAGAGG + Intronic
1194530592 X:95044275-95044297 ATGGGTGCCAAGTTGGCAAGGGG + Intergenic
1195348907 X:103978573-103978595 ATTGATGCGAAGATCGGAAGAGG + Intergenic
1195358536 X:104060266-104060288 ATTGATGCGAAGATCGGAAGAGG - Intergenic
1196265168 X:113635165-113635187 CATTATGCCACGTTGGGAAATGG - Intergenic
1197995477 X:132368091-132368113 ATTGAGGCCAAGTTGGGAAGAGG - Intergenic
1201935481 Y:19406911-19406933 CTTGGAGCAAAGTTGGAAAGAGG - Intergenic