ID: 963030591

View in Genome Browser
Species Human (GRCh38)
Location 3:140970948-140970970
Sequence CTTTATAAGCCAAATGGGGT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 1, 2: 1, 3: 15, 4: 185}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963030591_963030597 28 Left 963030591 3:140970948-140970970 CCAACCCCATTTGGCTTATAAAG 0: 1
1: 1
2: 1
3: 15
4: 185
Right 963030597 3:140970999-140971021 TTAATTCCTTAAAATAAAATTGG 0: 1
1: 0
2: 5
3: 110
4: 988
963030591_963030596 1 Left 963030591 3:140970948-140970970 CCAACCCCATTTGGCTTATAAAG 0: 1
1: 1
2: 1
3: 15
4: 185
Right 963030596 3:140970972-140970994 CTCGGTTACAGCTTGATGCAAGG 0: 1
1: 0
2: 0
3: 2
4: 48

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963030591 Original CRISPR CTTTATAAGCCAAATGGGGT TGG (reversed) Exonic
913972881 1:143429212-143429234 CTTTACAAGCTAGATGGGATTGG - Intergenic
914067265 1:144254819-144254841 CTTTACAAGCTAGATGGGATTGG - Intergenic
914111888 1:144711535-144711557 CTTTACAAGCTAGATGGGATTGG + Intergenic
918616913 1:186554955-186554977 CTTTAAAACCCAAGTGGGTTTGG - Intergenic
920179048 1:204121406-204121428 CCTTAGAAGTCAAATGGGGCTGG - Intronic
921232773 1:213089756-213089778 CTTTAACAGCAAAATGGGGCCGG - Intronic
924543260 1:245001262-245001284 CTTTATAGGCTAAATGGTCTTGG - Intronic
1063759128 10:9052339-9052361 CTAGATAAACCAAATGGGGGTGG + Intergenic
1068311493 10:55282868-55282890 GATTAGAAGCAAAATGGGGTTGG - Intronic
1068352848 10:55871406-55871428 CTTAATGAGGCAAATGTGGTTGG + Intergenic
1068715340 10:60181394-60181416 CTTGAGCAGCCAAATGGAGTGGG + Exonic
1069275363 10:66585009-66585031 CCTTATAAGCCAGATGGAATTGG - Intronic
1072857039 10:98958740-98958762 ACTTATATGCCACATGGGGTAGG + Intronic
1074059562 10:109952535-109952557 TTTGATAAGCCATATGGGGTTGG + Intronic
1074834741 10:117279451-117279473 CTTTATAAACCAAATGTTGTTGG + Exonic
1076376040 10:129985807-129985829 CTCTATAAGCTAGATGGGATTGG + Intergenic
1077532323 11:3103119-3103141 CCTTCTAAGCCATGTGGGGTAGG + Intronic
1078277683 11:9865813-9865835 CTCTATAAGCCAAACTGGCTGGG - Intronic
1079464017 11:20711709-20711731 CTTTTCAAGCCAAAAGGGGTTGG - Intronic
1081293209 11:41351656-41351678 CTTTAAAAGCCAAAAGAGATTGG + Intronic
1083077912 11:60060586-60060608 ATTTATAAGCCATATGAGTTTGG + Intronic
1083853530 11:65380927-65380949 CTTTGTAAGCCCAACAGGGTGGG + Intronic
1085049877 11:73374984-73375006 CTCAATAAACCAAATGGGGAAGG - Intergenic
1087405905 11:97730129-97730151 CTTTAAGAGCCAAATGGCCTTGG + Intergenic
1087568872 11:99897461-99897483 CCTTACAAGCCAAAAGAGGTTGG + Intronic
1087984246 11:104657868-104657890 TTTTATAAGCCAATTGGGGTGGG - Intergenic
1090086569 11:123655073-123655095 CTGTTTAGGGCAAATGGGGTAGG + Intronic
1091143963 11:133261008-133261030 CCTTATAAACCAAATGGAGCTGG - Intronic
1091168580 11:133501597-133501619 CTTATCAAGCCAATTGGGGTGGG - Intronic
1093110611 12:15147367-15147389 CTTTACAAGCCAAATGAGATGGG + Intronic
1093370084 12:18355383-18355405 GTTTAAAAGGCAAATGGGGGTGG + Intronic
1097811393 12:64023058-64023080 CTTTATCAGTGAAATGGGGATGG + Intronic
1104337032 12:127908849-127908871 ATTAAAAAGACAAATGGGGTCGG + Intergenic
1105523060 13:21148825-21148847 CTTTGTAAGCCAAAGTGGTTGGG + Exonic
1108873120 13:55011388-55011410 TTTTATAAGCCAAGTGAGCTTGG - Intergenic
1109058162 13:57579702-57579724 CTTTACAAGCCAGAAGGGATTGG - Intergenic
1112137710 13:96600994-96601016 CCTTCCAAGCCAAAAGGGGTTGG - Intronic
1117939229 14:60943459-60943481 GTTTATAAGCCATATGGCCTGGG - Intronic
1119019887 14:71100419-71100441 CTTTATAAGCCAGAAGGGATTGG - Intronic
1119877352 14:78072258-78072280 CTTTATGTGCCCGATGGGGTTGG + Intergenic
1120279232 14:82418551-82418573 CTTTATAAGCCAGAAGAGATTGG - Intergenic
1120645186 14:87065516-87065538 CTTTAGAAGGCAAATGGGTCTGG + Intergenic
1121523400 14:94601664-94601686 CTTTCTAAGGCAGAAGGGGTGGG - Intronic
1122930545 14:104931347-104931369 CTTTATCAGCCCACGGGGGTGGG + Intronic
1125445925 15:39756273-39756295 TGTTATAAGCCAACTGGGATGGG + Intronic
1126310301 15:47308310-47308332 CCTTATATGCCAAATGGGAATGG + Intronic
1129877237 15:78983661-78983683 CTTGACAAGCCAAACGAGGTTGG + Intronic
1131156187 15:90077179-90077201 CTTAATAAACAAAATGGGGACGG + Intronic
1133624606 16:7559462-7559484 ATTTTTAAGGCAGATGGGGTTGG - Intronic
1135809839 16:25577054-25577076 GGTTATAAGCAAAATGGAGTTGG + Intergenic
1135875187 16:26192283-26192305 CTTTTTAGGCCCAATGCGGTAGG - Intergenic
1136128150 16:28200236-28200258 TTTTATAAGCCAAATGGAGCTGG - Intronic
1136141254 16:28290287-28290309 CTGTAAAATACAAATGGGGTTGG - Intergenic
1138117360 16:54371102-54371124 CTTTCTGAGCCACATGGGGTGGG - Intergenic
1138441364 16:57036990-57037012 CTTTATTTTCCAAATGGGATGGG + Intronic
1139134372 16:64183801-64183823 GTTTATAAACCAAATGATGTTGG + Intergenic
1139196115 16:64920497-64920519 CTTTATTAGCCACATGGGAACGG - Intergenic
1142623255 17:1178234-1178256 CTTGATAAGTCATATGGGGGGGG - Intronic
1145772818 17:27505614-27505636 CTTTATCAGTAAAATGGGGATGG + Intronic
1146448538 17:32952943-32952965 CTTCATAAGACAAATGGGGCTGG - Intergenic
1147128736 17:38392936-38392958 CTTTATATGTGAAATGGGGATGG + Intronic
1148890790 17:50805806-50805828 ATTCATTAGCCACATGGGGTGGG + Intergenic
1149229522 17:54517486-54517508 CTCTATAAGCCAAAAGAGATTGG - Intergenic
1149526750 17:57362158-57362180 CTTTGTAAACAAAATGAGGTTGG + Intronic
1150351647 17:64449690-64449712 CTTTGGAAGGCTAATGGGGTAGG + Intronic
1153094501 18:1384927-1384949 CCTTATAAGCCAGAAGGGGTTGG + Intergenic
1153530954 18:6045197-6045219 CCTTATGAGCCAAAAGGGATTGG + Intronic
1158235936 18:55314028-55314050 TTCCCTAAGCCAAATGGGGTGGG - Intronic
1158652124 18:59297574-59297596 CTTAAAAATCCAGATGGGGTTGG - Intronic
1159730822 18:72024613-72024635 CTTTAAAAGCCGCATGGGGCCGG - Intergenic
1160820892 19:1057269-1057291 CTTTATCAGCCTAAAGAGGTGGG - Intronic
1165408948 19:35646715-35646737 CTTTAGAGGCCAGATGGGGGAGG + Intergenic
1166246914 19:41535521-41535543 CTTTAGAAGTCACTTGGGGTGGG - Intergenic
1168442909 19:56386644-56386666 CTCTTTAAGTCAACTGGGGTTGG - Intronic
926235360 2:11038942-11038964 CTTTACAAGCCAGAAGGGTTTGG - Intergenic
927420596 2:22926448-22926470 CTTAATAAGCCAAGGTGGGTTGG - Intergenic
928110091 2:28500387-28500409 ATTTATAAACCACATGGGGCAGG - Intronic
930907858 2:56594688-56594710 CTTTATAAGTGAGATGGGGAGGG - Intergenic
932542112 2:72665512-72665534 CCTTATAAGCCAAAAGAGATTGG + Intronic
932939472 2:76145679-76145701 CTTTAGAAGGCAAATGGAGAAGG + Intergenic
933482410 2:82874643-82874665 CCTTATAAGCCAAAAGGGACTGG - Intergenic
935226633 2:101058510-101058532 CTTTAAAAGCCCCATCGGGTTGG - Intronic
936750540 2:115635678-115635700 CTCTAGAAGCCCAATGGGGAGGG + Intronic
937521173 2:122713745-122713767 CTTTGTAAGCCAAAAGAGATTGG + Intergenic
939047506 2:137267339-137267361 CTTCATAGGCCTAATGAGGTTGG + Intronic
939870327 2:147519585-147519607 CTTCAGAAGGCAAGTGGGGTAGG - Intergenic
941905242 2:170713353-170713375 CTTCAGAAGCCAGATCGGGTCGG + Exonic
946949723 2:224860529-224860551 CTTTATTAGCCAAGTGAGCTTGG - Intronic
947145851 2:227064698-227064720 CCTTACAAGCCAAAAGGGATTGG + Intronic
947369168 2:229427295-229427317 CTTTAATAGCCACATGGGGAAGG + Intronic
947618462 2:231573828-231573850 GTTAATAAGCCCCATGGGGTAGG - Intergenic
947847176 2:233253928-233253950 CTTTGAAAGTCAAATTGGGTGGG + Intronic
1168838117 20:891297-891319 CTCTATCTGCCAAATGGGGCTGG + Intronic
1170487832 20:16837746-16837768 CTTTACAAAGCAAATGGCGTGGG - Intergenic
1172191360 20:33063722-33063744 CTGTATGACCCCAATGGGGTAGG + Intronic
1173046738 20:39519939-39519961 CTTTCTATGCCAAGTTGGGTGGG + Intergenic
1175275599 20:57768255-57768277 CTTTAAGAGCCAAATGGAGAAGG - Intergenic
1184208746 22:43022980-43023002 CTTTATAAGCCACACGGCTTTGG + Intergenic
949221648 3:1641725-1641747 TTGTATAAGACAAATGGGGAAGG + Intergenic
949909413 3:8888758-8888780 CTCTATAAAACAAATGGGTTGGG + Intronic
950595204 3:13974265-13974287 CCTTATAAGCCAGAAGGGATTGG - Intronic
950711022 3:14812764-14812786 CTTTATCTGAAAAATGGGGTTGG + Intergenic
950787380 3:15447935-15447957 CTTTAAAAGTCCACTGGGGTGGG - Intronic
953382358 3:42481774-42481796 CTTTACAAGCCAGAAGGGATTGG + Intergenic
953433053 3:42855346-42855368 CCTTATAAGGCAAATTGGGAAGG - Intronic
955445974 3:59009873-59009895 CTTTACAAGCCAGAAGGGATTGG + Intronic
956706635 3:72004815-72004837 GGTTAGAAGCAAAATGGGGTCGG - Intergenic
956708376 3:72019002-72019024 CTTAATAAGGAAAGTGGGGTGGG - Intergenic
956935961 3:74102197-74102219 CTTTCTGATCCAAATGGGCTTGG - Intergenic
960231449 3:115232416-115232438 TTTTATAAGCCAAGTGGCTTAGG + Intergenic
960888860 3:122424697-122424719 TTTTATAAGCCAATTTGAGTGGG - Exonic
962082692 3:132157450-132157472 CTTTCTCAGCCCAATGGGATTGG - Intronic
962594935 3:136932370-136932392 CTTTATAAGCCCATTCAGGTAGG - Intronic
963030591 3:140970948-140970970 CTTTATAAGCCAAATGGGGTTGG - Exonic
963352795 3:144172933-144172955 CTTAATAAGCCAATTGGCGACGG - Intergenic
963840935 3:150105711-150105733 CTTTGTATGCATAATGGGGTTGG + Intergenic
964018589 3:151978716-151978738 CTTGATAAGCCATATGGAGGCGG - Intergenic
971519492 4:27531134-27531156 CTTTATAAGACAAATGGACTTGG - Intergenic
973643715 4:52929063-52929085 ATTTATCAGCCAATTGAGGTTGG - Intronic
973864073 4:55094324-55094346 CTTGATAAGCCGCTTGGGGTAGG + Intronic
974942646 4:68487989-68488011 CCTTATAAGCCAAAAGAGATTGG - Intronic
975290738 4:72675916-72675938 CCTTATAAGCCAGAAGGGATTGG - Intergenic
975517416 4:75261653-75261675 CCTTACAAGCTAAATGGGATTGG + Intergenic
976666525 4:87600041-87600063 TCTTATAAGCCAAAAGGGATTGG + Intergenic
977285542 4:95101588-95101610 ATTTTTAAGCCAAATGTGGGGGG - Intronic
977743470 4:100515973-100515995 CTCTCTAAGACAAATGGAGTAGG + Intronic
978156518 4:105495202-105495224 CCTTATAAGCCCACTGGCGTTGG + Intergenic
978269988 4:106877341-106877363 CTTTATAAGGCAAAAGTGATAGG + Intergenic
979434903 4:120676125-120676147 CTGTATAAGCCAGAAGGGATTGG + Intergenic
980074019 4:128274909-128274931 TTTTATCTGCCAAATGGGGAAGG - Intronic
980425834 4:132627343-132627365 ATTTATAAGCCAACTGGGAAAGG + Intergenic
980697872 4:136383079-136383101 TTTTATATGCCAACTTGGGTGGG + Intergenic
980703343 4:136459293-136459315 CGTTTTCAGCCAAATGGGGCAGG + Intergenic
981923609 4:150114715-150114737 CCTTATAAGCCAAAAGGGAGTGG - Intronic
982187997 4:152821800-152821822 CCTTATAAGCCAGAAGGGATTGG + Intronic
984335199 4:178380787-178380809 CTTTATAAGCCAGAAGAGATTGG + Intergenic
986539704 5:8830849-8830871 CTTTACAAACCAGATGGGATTGG + Intergenic
986790699 5:11156850-11156872 ATTTAAAAGCCAAATGATGTTGG + Intronic
991595536 5:68301669-68301691 CTTCACAAGGCAACTGGGGTGGG + Exonic
993304368 5:86256642-86256664 CTTTATAAGCCAAAGTAGGCAGG + Intergenic
993884563 5:93400387-93400409 CTGTGTAAGACATATGGGGTTGG - Intergenic
995145684 5:108785282-108785304 CTTTATATGCCAGATGGTGGGGG + Intronic
995612140 5:113922126-113922148 TTTTAAAAGCCAAATGTGGCCGG - Intergenic
997892787 5:137689871-137689893 CTGTATCAGCCAATTAGGGTGGG + Intronic
999227345 5:150036969-150036991 CAGTATGAGCCAAATGGGATGGG - Intronic
999683821 5:154084697-154084719 CTTAATCAGCAAAATGGGGATGG - Intronic
1004411051 6:15381985-15382007 CTTTAACAACCAAATGGGGCTGG + Intronic
1004627729 6:17393036-17393058 CTTAAGAAGCCAAGTGGGTTTGG + Intergenic
1006290092 6:33128204-33128226 CTATAGAAGAAAAATGGGGTCGG - Intergenic
1006428484 6:33980684-33980706 CTTTCTAAGCAAGGTGGGGTGGG - Intergenic
1007687207 6:43673970-43673992 CTTAAAAAGCCAGAGGGGGTGGG + Intronic
1008528914 6:52436032-52436054 CTTTATAAAATAAGTGGGGTTGG + Intronic
1008901761 6:56627470-56627492 CTTTGAAAACCACATGGGGTGGG - Intronic
1009754368 6:67917414-67917436 CTTTATAAGGCATATGTGCTTGG + Intergenic
1010132059 6:72505827-72505849 ATTTAAAAACCAAATGAGGTAGG - Intergenic
1011514821 6:88142282-88142304 CTTTTTTAGCCACATGGGCTGGG + Exonic
1011951795 6:92975890-92975912 ATTTTAAAGCCAAATGTGGTGGG - Intergenic
1014720757 6:124915098-124915120 CTTAGAAAGCCAAGTGGGGTAGG + Intergenic
1016124035 6:140376654-140376676 CTTTATAAGCCAAAGAAGGAAGG - Intergenic
1017247927 6:152247256-152247278 CTTTTTAATCCAAGTTGGGTAGG + Intronic
1018781618 6:167072843-167072865 CCCTATAAGCCAAAAGGGATTGG - Intergenic
1020423511 7:8037205-8037227 CTCTATAAGCCAGAAGAGGTTGG + Intronic
1020450209 7:8313252-8313274 CTTTACAAGCCAGAAGGGATTGG - Intergenic
1022539031 7:31119032-31119054 TTTTAAAAGTCACATGGGGTTGG - Intergenic
1024641822 7:51335309-51335331 CTGTATAAGCCAAATAGGAGAGG + Intergenic
1024853291 7:53745863-53745885 CCTTACAAGCCAAAAGAGGTTGG + Intergenic
1025909828 7:65819411-65819433 CTTTATAAGAGAAAGGAGGTAGG + Intergenic
1028533691 7:91866951-91866973 CTTTAAATGCCAAAAGAGGTCGG - Intronic
1029559702 7:101294514-101294536 CGTTAGAAGCAAGATGGGGTTGG + Intergenic
1029950228 7:104576328-104576350 TTTTGTAAGCCAAATGTGGGAGG + Intronic
1031952167 7:127903654-127903676 CCTCATAAGCCAAATTGGGTGGG - Intronic
1033532802 7:142282471-142282493 CTTCATAAGCCACATGGGATGGG - Intergenic
1034708353 7:153168501-153168523 CTTTATAAGCCAAAAGAGATTGG - Intergenic
1038341681 8:26691420-26691442 CATGATAAGCCAAAAAGGGTGGG + Intergenic
1038789004 8:30650547-30650569 TTTAATTAGCCAAATGTGGTGGG + Intronic
1040626504 8:49155805-49155827 CTTTACAAGCCAGAAGGGATTGG + Intergenic
1040838477 8:51758357-51758379 CTTTATGAACCAAATATGGTCGG - Intronic
1041220531 8:55647001-55647023 CCTTATAAGCCAAAAGAGATTGG - Intergenic
1042531490 8:69820338-69820360 AGTTATAAGCCAGCTGGGGTGGG - Intronic
1044774775 8:95676930-95676952 CCTTACAAGCCAAATGGGGAAGG - Intergenic
1048358464 8:133673723-133673745 CTTTATAAGCCAAATGGGGATGG + Intergenic
1051882743 9:21856628-21856650 CTTTAGTAGCCAAATGAGGTTGG + Intronic
1054720821 9:68602071-68602093 CTTTATAAGCCAGAGGTGATTGG - Intergenic
1055303077 9:74902434-74902456 CTCTATAGGCCAAATGGCTTGGG - Intergenic
1057340367 9:94195911-94195933 CTTTACAATCCAAAAGGGATTGG - Intergenic
1057907872 9:98996236-98996258 CTTTCTAAGCTAAAGGGGCTGGG - Intronic
1059685770 9:116634292-116634314 CTTAATAAGCAAAATAGGGCCGG + Intronic
1059980575 9:119767172-119767194 CTTTATAAATCAATTGGAGTTGG + Intergenic
1062450475 9:136613789-136613811 CTGCAGAAGCCAAATGGGCTTGG + Intergenic
1186816376 X:13241824-13241846 GTTTAGAAGCAAAATGGAGTTGG - Intergenic
1188768915 X:34129578-34129600 CTTTAAAAGAGAAATAGGGTCGG - Intergenic
1189314769 X:40047116-40047138 CTCTATAAGACACATGGGGCTGG - Intergenic
1190773298 X:53533054-53533076 CTTTTTAAAACACATGGGGTGGG + Exonic
1193549176 X:82869586-82869608 CTTTACAAGCCAGAAGGGATTGG - Intergenic
1193657665 X:84218310-84218332 CTCTTTCAGCCAAATGGGTTTGG - Intergenic
1194171927 X:90597100-90597122 CTTTACAAGCCAGATGAGATTGG - Intergenic
1194480925 X:94423385-94423407 CCTTATAAGCCAGAAGGGATTGG - Intergenic
1197067063 X:122245995-122246017 GTTTAGAAGCCAGATGGAGTCGG + Intergenic
1199099263 X:143779956-143779978 CTTTATAAGCCAGAAGAGTTTGG - Intergenic
1199605383 X:149574036-149574058 CTTTATAAGACGAATGGTGGAGG - Intergenic
1199633738 X:149795332-149795354 CTTTATAAGACGAATGGTGGAGG + Intergenic
1200474401 Y:3627203-3627225 CTTTATAAGCCAGAAGAGATGGG - Intergenic
1200518156 Y:4174850-4174872 CTTTACAAGCCAGATGAGATTGG - Intergenic