ID: 963030592

View in Genome Browser
Species Human (GRCh38)
Location 3:140970952-140970974
Sequence GAGTCTTTATAAGCCAAATG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 184}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963030592_963030596 -3 Left 963030592 3:140970952-140970974 CCCCATTTGGCTTATAAAGACTC 0: 1
1: 0
2: 1
3: 9
4: 184
Right 963030596 3:140970972-140970994 CTCGGTTACAGCTTGATGCAAGG 0: 1
1: 0
2: 0
3: 2
4: 48
963030592_963030597 24 Left 963030592 3:140970952-140970974 CCCCATTTGGCTTATAAAGACTC 0: 1
1: 0
2: 1
3: 9
4: 184
Right 963030597 3:140970999-140971021 TTAATTCCTTAAAATAAAATTGG 0: 1
1: 0
2: 5
3: 110
4: 988

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963030592 Original CRISPR GAGTCTTTATAAGCCAAATG GGG (reversed) Exonic
902732733 1:18380223-18380245 CAGGCTCTAGAAGCCAAATGGGG + Intergenic
904704963 1:32382993-32383015 TAGTCTAAATAACCCAAATGTGG + Intronic
905618322 1:39417402-39417424 GAGTCTTTTTAAGCAAAAATTGG + Intronic
907510395 1:54953795-54953817 GTATCCTCATAAGCCAAATGCGG - Intergenic
908084951 1:60622050-60622072 GAGTCTTTGAAAGAAAAATGAGG - Intergenic
910271952 1:85405582-85405604 AAGTCTTTCCCAGCCAAATGCGG - Intronic
910640045 1:89450261-89450283 AAGTATTTATAAGGCAACTGTGG - Intergenic
912084987 1:105989439-105989461 AAGCCTTTTGAAGCCAAATGTGG - Intergenic
912687550 1:111779150-111779172 GACTCTATCTGAGCCAAATGTGG - Intronic
915736369 1:158088045-158088067 GAGTCGCTATGAGACAAATGTGG + Exonic
917632488 1:176904003-176904025 GTGTCTTTATAAGAGAAATGAGG - Intronic
917655598 1:177122496-177122518 GATTTTTAAGAAGCCAAATGGGG + Intronic
923451162 1:234118575-234118597 GAGCCTTTGTAAGCCATATCTGG - Intronic
1063538174 10:6905918-6905940 GAGTCTTTTCAGGCCAGATGTGG + Intergenic
1063864086 10:10345092-10345114 GAAACTTTGTAAGCAAAATGTGG + Intergenic
1064959330 10:20946139-20946161 GAGTCTTGAACAGCTAAATGAGG + Intronic
1068090365 10:52425780-52425802 GTTTCGTTATATGCCAAATGTGG - Intergenic
1070176466 10:73974631-73974653 TAGTCTTTAAAAGCCAAATATGG - Intergenic
1070217245 10:74398027-74398049 AAGCCTTTAAAAGCCAAATATGG - Intronic
1072198358 10:93136526-93136548 GAGACTTTATAACACAAATTTGG - Intergenic
1073473679 10:103739352-103739374 GAGTTTTTGGAAGCCCAATGGGG + Intronic
1074301397 10:112236261-112236283 GAGTCTTAATAAGCCCAGGGTGG - Intergenic
1075315498 10:121449969-121449991 GAGTGTGTATAAGCCAGGTGTGG + Intergenic
1079151892 11:17907300-17907322 GAGTCTTCATCTGCAAAATGAGG + Intronic
1079199583 11:18364423-18364445 AAGTCAGTATAAGCCAGATGCGG + Intronic
1080125163 11:28724821-28724843 GATTCTTATTAAGCCAAACGTGG + Intergenic
1081015236 11:37870121-37870143 GAGTTTTTTTCAACCAAATGTGG + Intergenic
1087568870 11:99897457-99897479 GAGACCTTACAAGCCAAAAGAGG + Intronic
1087808432 11:102582133-102582155 GAGTCCTTAGAATACAAATGTGG - Intronic
1087984248 11:104657872-104657894 TAGTTTTTATAAGCCAATTGGGG - Intergenic
1090343542 11:126047625-126047647 TAGTCTTTACAGGCAAAATGAGG - Intronic
1092521073 12:9273787-9273809 AAGTCTCTATATTCCAAATGAGG + Intergenic
1093299826 12:17440490-17440512 AAGTCTTTAAAAGCCAATTGAGG - Intergenic
1093588791 12:20873980-20874002 TAGACTGTATAAGGCAAATGTGG - Intronic
1098421843 12:70305923-70305945 CAGTATTTCAAAGCCAAATGTGG - Intronic
1099006522 12:77240594-77240616 GGGGCTTCATAAGCCAATTGAGG + Intergenic
1099297515 12:80847716-80847738 GAGTCTTTAAAGGGCAGATGTGG + Intronic
1106363546 13:29054952-29054974 GAATCTTTATAAGCTTATTGTGG + Intronic
1107212451 13:37873736-37873758 GAGTTATTATAAACCAAATGGGG - Intergenic
1111544413 13:89712039-89712061 GACTCATTATGAGCCAAATAGGG - Intergenic
1113181792 13:107637128-107637150 GAGTGTGTTTAAGCAAAATGAGG - Intronic
1114962880 14:27917247-27917269 TATTTTTTATAAGCCAAAAGTGG - Intergenic
1116160492 14:41261788-41261810 CAGCATTTATAAGCAAAATGAGG - Intergenic
1116180022 14:41520550-41520572 GAGCCTTTATTAGTCAAATCAGG + Intergenic
1116982139 14:51183039-51183061 GATCCCTTATAAGCCAAGTGTGG + Intergenic
1118364732 14:65085030-65085052 AAGTGTTTATTAGCCACATGTGG - Intronic
1119879680 14:78090477-78090499 GTGACTTCAGAAGCCAAATGCGG + Intergenic
1119932492 14:78561855-78561877 GACTCATTATAAGCCTCATGTGG + Intronic
1122383248 14:101325219-101325241 GAATGATAATAAGCCAAATGCGG - Intergenic
1126160333 15:45606547-45606569 GAGTCATCATAACCCAAATATGG - Exonic
1127717054 15:61658806-61658828 GAGACGTTAAAAGACAAATGAGG - Intergenic
1130391314 15:83458146-83458168 GAATCTTTAGCAGCAAAATGTGG + Intronic
1131834673 15:96378391-96378413 GAGGCTTTCTTAGCCACATGTGG + Intergenic
1133423391 16:5666134-5666156 GAGCCTTTACAAGCCACATTTGG + Intergenic
1135204646 16:20473044-20473066 GTATCTTCATAAGCAAAATGAGG - Intronic
1135214244 16:20550768-20550790 GTATCTTCATAAGCAAAATGAGG + Intronic
1135382313 16:22005292-22005314 GAGTCTTGTTAGGCCAGATGGGG + Intergenic
1137588881 16:49681468-49681490 CAGGCTTTATAAAGCAAATGGGG + Intronic
1141188440 16:81806172-81806194 GAGTGTTCAAAAGCCACATGTGG + Intronic
1149637197 17:58180571-58180593 GAGTCTTCATAAAGCCAATGGGG + Intergenic
1152920009 17:83061916-83061938 GAGTCTTCATCAGGAAAATGTGG - Intergenic
1154084717 18:11292157-11292179 GAGTTCTTATAAGCCTACTGAGG - Intergenic
1156027203 18:32668931-32668953 GAGGCTATATAAGCTACATGAGG - Intergenic
1156173190 18:34511069-34511091 CAGTCTCTATAAGCTTAATGTGG - Intronic
1159577769 18:70200818-70200840 GTGTCTTTATTAGTAAAATGTGG + Intronic
1162416066 19:10538350-10538372 GTTTCTTTATCTGCCAAATGGGG - Intergenic
1164756018 19:30690238-30690260 GAGTCTTTTCACCCCAAATGTGG - Intronic
1165408946 19:35646711-35646733 GAGGCTTTAGAGGCCAGATGGGG + Intergenic
1167162611 19:47778183-47778205 AGGTCTTTATAAGGCAACTGTGG + Intergenic
1167635484 19:50652483-50652505 GAGACTTGATTAGCCAAATGAGG + Intronic
1168442910 19:56386648-56386670 GAGTCTCTTTAAGTCAACTGGGG - Intronic
928926606 2:36586304-36586326 TAGTATTTATAAGCCAGAAGGGG - Intronic
929094795 2:38253122-38253144 GGGTTTTTCTAAACCAAATGTGG - Intergenic
931796537 2:65715701-65715723 GAGTCTTTCTACTCAAAATGTGG + Intergenic
932528689 2:72502051-72502073 GAGTTTTTTTAGGCCAAGTGTGG - Intronic
933425434 2:82105728-82105750 GTGTCTGTATAAGAGAAATGAGG - Intergenic
935439011 2:103069589-103069611 GAGTTTTAATAGGCAAAATGAGG - Intergenic
936606582 2:113963546-113963568 CAGTCTTCAAAAGCCAAGTGAGG - Intergenic
938649415 2:133366772-133366794 GAGACTTTAAAAGTCATATGGGG + Intronic
939884051 2:147661975-147661997 GGGTCTTGCTATGCCAAATGAGG - Intergenic
942297316 2:174530314-174530336 CAGTCTTTGTAACCCAAATCAGG + Intergenic
943315994 2:186387993-186388015 GAATCTTTAAATGACAAATGAGG - Intergenic
944013412 2:195002177-195002199 GATTCTTCATAGGCAAAATGAGG + Intergenic
945987255 2:216364809-216364831 GATTCTGTACTAGCCAAATGGGG - Intronic
946669353 2:222085829-222085851 GAGTCTTTAAAAACATAATGGGG + Intergenic
946791733 2:223307811-223307833 GAGTTTATATAAGGGAAATGCGG - Intergenic
1171449960 20:25228621-25228643 GAGTCATCAGAAGGCAAATGTGG + Intergenic
1172475392 20:35233602-35233624 GAGTCATTTTAAGCCAGGTGAGG - Intronic
1174066344 20:47868395-47868417 GAGTCTGCATCAGCCAAATCAGG - Intergenic
1175019936 20:55835137-55835159 GGGTCTTTATAAGACGAAGGCGG - Intergenic
1178268332 21:31166176-31166198 GAGTCTTTCTATTCCAAGTGTGG - Intronic
1179475983 21:41645021-41645043 GTGTCTTTATAGGGCAAATTGGG + Intergenic
1180072588 21:45443740-45443762 GAGTCTTTATGAGAGCAATGCGG + Intronic
1180651430 22:17380488-17380510 GACTCTTTATGAGCTAAATCAGG + Intronic
1180785551 22:18545379-18545401 GATACTTTAAAAGCCAGATGTGG - Intergenic
1181129137 22:20719419-20719441 GATACTTTAAAAGCCAGATGTGG - Intronic
1181242457 22:21484731-21484753 GATACTTTAAAAGCCAGATGTGG - Intergenic
1181550540 22:23636720-23636742 GGGTCTTTATAAGGGAAAGGAGG + Intergenic
1181797739 22:25321972-25321994 GGGTCTTTATAAGGGAAAGGAGG - Intergenic
1182130775 22:27848983-27849005 TAGTCTGTATGAGCCAAATGAGG + Intergenic
1183782714 22:40009045-40009067 GGATCGTTATAAGGCAAATGGGG - Intronic
1184377246 22:44121697-44121719 TAGTCTCTTTAAGCCAAAAGAGG + Intronic
949221647 3:1641721-1641743 AAGTTTGTATAAGACAAATGGGG + Intergenic
951665666 3:25120748-25120770 GAGACTTCATAAGCAATATGAGG + Intergenic
954505129 3:51063080-51063102 GAATCTTTAAAAGTCTAATGGGG + Intronic
954567471 3:51610691-51610713 GAATCTTTATATCCCAAAAGGGG - Intronic
955290504 3:57688284-57688306 GACTCTTAATAAGCCGAGTGTGG - Intronic
956895012 3:73650670-73650692 GAGTGCTTAATAGCCAAATGTGG - Intergenic
962195978 3:133363959-133363981 GAGTGCTTAATAGCCAAATGTGG + Intronic
963030592 3:140970952-140970974 GAGTCTTTATAAGCCAAATGGGG - Exonic
966607815 3:181839167-181839189 GAGTTGTTTTAACCCAAATGGGG + Intergenic
970219060 4:13789454-13789476 GAGATTTTATAGGCTAAATGTGG + Intergenic
973022479 4:45220601-45220623 GAGTCTTTATAGGCACAATATGG + Intergenic
973734988 4:53862968-53862990 GAGTTTTCATTAGTCAAATGGGG - Intronic
974108325 4:57496741-57496763 GAGTCTTTAAAATGAAAATGTGG + Intergenic
975231403 4:71938224-71938246 ATGTCTTTATAAGCCATTTGTGG + Intergenic
975274037 4:72473991-72474013 GAGTAAATAGAAGCCAAATGAGG + Intronic
975619146 4:76278068-76278090 GAATCCTTATAAGCCAAAGTGGG + Exonic
976072255 4:81255028-81255050 GAGTCTTTAGAAACCCAATTAGG + Intergenic
976949048 4:90806791-90806813 AATTCTCTATGAGCCAAATGAGG - Intronic
977579839 4:98713254-98713276 AATTCTTTATTAGCCAAAGGTGG + Intergenic
978420856 4:108531355-108531377 GAGTCTTTCTCACCCAAATAAGG + Intergenic
979621360 4:122801936-122801958 GAGTCTCTACTAGCCAAATCTGG + Intergenic
982726759 4:158914705-158914727 GGGTTTTTATAAGTAAAATGGGG - Intronic
985470367 5:38601-38623 GAGAATTTATAAGCAAATTGAGG + Intergenic
986523337 5:8644959-8644981 GAGTCTTTATATGCCAGTTTAGG + Intergenic
987401620 5:17483600-17483622 TAGTCTTTAAGAGACAAATGGGG + Intergenic
988125970 5:27037709-27037731 GAGTGTTTCTAAGCCAAAATTGG - Intronic
989422094 5:41252226-41252248 GAATCTCTACCAGCCAAATGAGG - Intronic
991243741 5:64487669-64487691 GAGACTTTATAAGGAAAAGGAGG - Intergenic
993073418 5:83195067-83195089 GCATCCTTATCAGCCAAATGGGG + Intronic
993254824 5:85576874-85576896 GAGTAATTATACACCAAATGTGG - Intergenic
993304367 5:86256638-86256660 AAATCTTTATAAGCCAAAGTAGG + Intergenic
994007244 5:94853459-94853481 GTGTGTTTTTAAGCCAAGTGTGG + Intronic
994056602 5:95423503-95423525 GAGTCCTAAAGAGCCAAATGGGG - Intronic
995173770 5:109149439-109149461 GAGTCTTTATAAATCTTATGAGG + Intronic
995840271 5:116437237-116437259 GAGTGTGTAAAAGTCAAATGAGG - Intergenic
996216590 5:120874641-120874663 CAGCCTTTCTAAGCCATATGTGG - Intergenic
996579053 5:125009695-125009717 GAATCTAAATATGCCAAATGAGG - Intergenic
996596191 5:125205712-125205734 GTCTCTTGCTAAGCCAAATGTGG - Intergenic
997998975 5:138609172-138609194 GAGTCTTTATGAGCCAGAAATGG - Intergenic
999076919 5:148805423-148805445 GAATTATTATAAGCCAGATGGGG + Intergenic
999914116 5:156238634-156238656 CAGTCATTATCAGCCACATGTGG - Intronic
1000470698 5:161637574-161637596 GGGTTTTTAAAAGACAAATGAGG - Intronic
1000759475 5:165204391-165204413 GAATATTTATAGGCCAAATTAGG - Intergenic
1001244176 5:170093451-170093473 GAGTCTTTAAAAGCAGAAAGAGG + Intergenic
1004686125 6:17946245-17946267 GATGCTTTATCAGCTAAATGTGG - Intronic
1008052216 6:46912015-46912037 GAGTCTTTACAATTCTAATGGGG + Intronic
1008098472 6:47365522-47365544 TAGACTTAATAAGCCAAAAGTGG + Intergenic
1014115778 6:117666775-117666797 GAGACTTTATAATCTAAATCAGG + Intergenic
1014487130 6:122013362-122013384 GAGTCTTTAAAAGTCAAACTTGG - Intergenic
1014619888 6:123654401-123654423 GGTTCTTTATTAGCAAAATGGGG - Intergenic
1015665250 6:135620825-135620847 CAGTGTTGATAAGCCAAAGGTGG + Intergenic
1016556332 6:145342301-145342323 GAGTCTCCCAAAGCCAAATGTGG + Intergenic
1018381965 6:163266257-163266279 TAGTCTTTAAAATCCAAATCCGG - Intronic
1021161308 7:17276252-17276274 GTCTCTTTAAAAGCCAACTGTGG + Intergenic
1023383044 7:39627342-39627364 TAGTCTTTACAAGCCAAAAAAGG + Intronic
1023959854 7:44917190-44917212 TAGTGTTTATAAGCCAAGTGTGG + Intergenic
1026960440 7:74404303-74404325 CAGTCTTTAAGAGCCAAGTGGGG + Exonic
1029351722 7:100017763-100017785 GTATCTTTATCAGTCAAATGGGG - Intronic
1029950226 7:104576324-104576346 TAGATTTTGTAAGCCAAATGTGG + Intronic
1030136360 7:106254638-106254660 GGGTCTTTAAAAACAAAATGCGG - Intronic
1030169323 7:106585748-106585770 TAGGCTATATAAGCCATATGAGG + Intergenic
1031369952 7:120952655-120952677 GAGTCTTTAAAAGGCTATTGTGG + Intronic
1031859317 7:126959365-126959387 GAGTGTTTAGAAGCAAAATTTGG + Intronic
1031898996 7:127389450-127389472 CAGTATTCATAATCCAAATGTGG + Intronic
1032626275 7:133594798-133594820 GAGTCTTTTTAAGCCTACTCTGG + Intronic
1032635213 7:133699466-133699488 GAGTCTGTAAAGGCAAAATGAGG + Intronic
1034003193 7:147439963-147439985 GTGTCTTTATAGGTGAAATGTGG + Intronic
1037514022 8:19611696-19611718 GAGTCTTTTTAAGCCATCAGAGG - Intronic
1038364894 8:26921233-26921255 GATTCTTTATATGTTAAATGTGG + Intergenic
1038789002 8:30650543-30650565 AAGTTTTAATTAGCCAAATGTGG + Intronic
1040698735 8:50035392-50035414 GAGTGTTCACAAGCCAGATGAGG - Intronic
1041609981 8:59834402-59834424 GATTCTTTATAATTCAAAGGAGG - Intergenic
1041740359 8:61150986-61151008 GGGCCTGTATAAGCCAGATGTGG + Intronic
1042187861 8:66154705-66154727 TAGTCTTTAGAAGCCCAAGGAGG - Intronic
1042613681 8:70625729-70625751 TAGTGTTTATCAGCCAAAAGAGG - Intronic
1043022290 8:75018579-75018601 AAGACTGTATAAGCCAGATGTGG - Intronic
1043580535 8:81707456-81707478 GACTCTTTAAAAGCAAAATGTGG - Intronic
1044426427 8:92056531-92056553 TAGCCTTTAAAAGCGAAATGTGG + Intronic
1044774777 8:95676934-95676956 AAATCCTTACAAGCCAAATGGGG - Intergenic
1047545262 8:125810442-125810464 GATTCTGTAGAACCCAAATGTGG + Intergenic
1048088994 8:131218326-131218348 TAGTTTTTTGAAGCCAAATGAGG - Intergenic
1048358463 8:133673719-133673741 GTCTCTTTATAAGCCAAATGGGG + Intergenic
1050663976 9:7914195-7914217 GTGTCATTATCTGCCAAATGGGG + Intergenic
1057643873 9:96854480-96854502 GAGTCTCGAGAACCCAAATGAGG + Exonic
1057684233 9:97218638-97218660 GAGCCTTTATTAGTCAAATCAGG + Intergenic
1059050610 9:110920820-110920842 TAGTATATATAAACCAAATGTGG + Intronic
1187800072 X:23052104-23052126 GAGTTTTTAAAAGTCAGATGAGG - Intergenic
1189314770 X:40047120-40047142 GAGACTCTATAAGACACATGGGG - Intergenic
1189843451 X:45107555-45107577 GAGGCTTTATAAAACAACTGTGG - Intronic
1194980031 X:100431082-100431104 GAGTCTATATTAGACAAATATGG + Intergenic
1194993086 X:100566041-100566063 TAGTCTTAATAAGCAAAAAGTGG + Intergenic
1196611987 X:117726097-117726119 GCTTCTTTATAAGCCACATTAGG + Intergenic
1199925053 X:152453546-152453568 GTGTCTTTATAAGAAAAAAGAGG - Intergenic