ID: 963030593

View in Genome Browser
Species Human (GRCh38)
Location 3:140970953-140970975
Sequence CGAGTCTTTATAAGCCAAAT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 60
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 55}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963030593_963030597 23 Left 963030593 3:140970953-140970975 CCCATTTGGCTTATAAAGACTCG 0: 1
1: 0
2: 0
3: 4
4: 55
Right 963030597 3:140970999-140971021 TTAATTCCTTAAAATAAAATTGG 0: 1
1: 0
2: 5
3: 110
4: 988
963030593_963030596 -4 Left 963030593 3:140970953-140970975 CCCATTTGGCTTATAAAGACTCG 0: 1
1: 0
2: 0
3: 4
4: 55
Right 963030596 3:140970972-140970994 CTCGGTTACAGCTTGATGCAAGG 0: 1
1: 0
2: 0
3: 2
4: 48

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963030593 Original CRISPR CGAGTCTTTATAAGCCAAAT GGG (reversed) Exonic
909825255 1:80119467-80119489 CTTTTCTTTATAAGCCAATTTGG + Intergenic
915609757 1:156982007-156982029 CCAGTATTGAAAAGCCAAATTGG - Intronic
918927099 1:190801689-190801711 TGAATTTTCATAAGCCAAATAGG - Intergenic
923408309 1:233684735-233684757 TGAGCCTTTATTAGTCAAATCGG - Intergenic
1063677242 10:8151815-8151837 CATGTCTTTCTCAGCCAAATGGG - Intergenic
1065768236 10:29052293-29052315 CGAGTCTGTCCAAGCCAATTTGG + Intergenic
1067700879 10:48571050-48571072 CGAGACCTTATAAGGCAAAGAGG - Intronic
1068762685 10:60731000-60731022 GGAATCTGTATAATCCAAATTGG - Intronic
1074125149 10:110522955-110522977 GGAGTTTTTATAAGCCCAAAGGG - Intergenic
1078277685 11:9865818-9865840 CAAGACTCTATAAGCCAAACTGG - Intronic
1078735123 11:14012587-14012609 CGAGTCTGTTTTTGCCAAATCGG - Intronic
1083139394 11:60709590-60709612 CAAGTGTTTAAAAGCCACATGGG + Intronic
1084217219 11:67654857-67654879 CATTTCTTTATAAGCCAATTCGG - Intergenic
1087984249 11:104657873-104657895 ATAGTTTTTATAAGCCAATTGGG - Intergenic
1090856270 11:130611582-130611604 CGAATCTTTGTAAACAAAATAGG + Intergenic
1107212452 13:37873737-37873759 AGAGTTATTATAAACCAAATGGG - Intergenic
1111401076 13:87735604-87735626 CAAGTCTTTATAGGCCAAGGTGG + Intergenic
1111544414 13:89712040-89712062 AGACTCATTATGAGCCAAATAGG - Intergenic
1112496848 13:99911871-99911893 CGAGAGTTTACAAGCCAACTGGG + Intergenic
1116182175 14:41549067-41549089 TGAATCTAAATAAGCCAAATAGG + Intergenic
1119783209 14:77292592-77292614 TGAGTTTTTATAACCCCAATTGG + Intronic
1126216918 15:46166062-46166084 TGAGTCTTTCTAAGCCAAACAGG + Intergenic
1139123891 16:64054126-64054148 CGTGTCTTTATAGGTCAAGTGGG - Intergenic
1156689397 18:39688149-39688171 CCTGGCTTTATAAGACAAATTGG - Intergenic
1158096796 18:53781782-53781804 CAAGTCTTGATATTCCAAATTGG - Intergenic
1160319066 18:77873462-77873484 CGATTCTTTATCAGCCATCTGGG - Intergenic
1161833543 19:6628789-6628811 CTTTTATTTATAAGCCAAATTGG + Intergenic
941067194 2:160916752-160916774 AGAGTCATTATAAGACAAACAGG + Intergenic
946026513 2:216674928-216674950 CTAGACTTTAGAAGCCAGATAGG - Exonic
1170032073 20:11954481-11954503 CGAGTATTTATCAGCCATGTGGG + Intergenic
1179475982 21:41645020-41645042 AGTGTCTTTATAGGGCAAATTGG + Intergenic
1182044416 22:27263006-27263028 CCAGTCCTCATAAGCCAAACAGG + Intergenic
1182696459 22:32202271-32202293 GGAGTCTTTATAAGGGAAAGAGG - Intronic
1183220499 22:36509404-36509426 AGAGTCTCTGTAATCCAAATTGG + Intergenic
1184327599 22:43801971-43801993 CGAGTCTTTATAGGTGAAGTGGG - Intronic
949484124 3:4521168-4521190 TGTGTGTTTATAAGCAAAATAGG + Intronic
956349471 3:68319073-68319095 ATAGTCTTAATATGCCAAATAGG - Intronic
963030593 3:140970953-140970975 CGAGTCTTTATAAGCCAAATGGG - Exonic
969698615 4:8751505-8751527 GGAGTCTGTATATGCCAATTAGG - Intergenic
975619145 4:76278067-76278089 AGAATCCTTATAAGCCAAAGTGG + Exonic
976282110 4:83335302-83335324 CAAGTGTTTATAAGCTAGATGGG - Intergenic
976282759 4:83341441-83341463 CAAGTGTTTATAAGCTAGATGGG - Intergenic
996285226 5:121783082-121783104 AGAGTCTTCATAAGTAAAATAGG + Intergenic
998513050 5:142729605-142729627 AGAGTCCTTATAAGAAAAATTGG - Intergenic
1000558152 5:162752821-162752843 CGAGTCTTTAAAAGCAGAAGTGG - Intergenic
1005422118 6:25662317-25662339 CAAGTCCTTATCAGCAAAATAGG - Intronic
1011938844 6:92817087-92817109 CAATTCTTTTTAAGGCAAATAGG + Intergenic
1021421743 7:20453352-20453374 CCTTTGTTTATAAGCCAAATAGG + Intergenic
1021574151 7:22092334-22092356 AGCTTCTTTATATGCCAAATGGG - Intergenic
1024550401 7:50558342-50558364 GGAGTCCTTATGAGCCAATTTGG + Intronic
1026960439 7:74404302-74404324 CCAGTCTTTAAGAGCCAAGTGGG + Exonic
1033320565 7:140335914-140335936 CCAGTCTTTAGAAGCTAGATGGG + Intronic
1037110311 8:15157863-15157885 CGTTTCTTTGTAGGCCAAATGGG - Intronic
1043027346 8:75086432-75086454 CAAGTCTTTCTAAGGCAAATTGG + Intergenic
1043199548 8:77348947-77348969 CAAGTTTTTATAAGCCTAAAAGG - Intergenic
1045005080 8:97910356-97910378 TGATTCTTTAAAAACCAAATCGG - Intronic
1045998717 8:108394529-108394551 CCAGTTTTGATAAGCCACATTGG - Intronic
1048358462 8:133673718-133673740 TGTCTCTTTATAAGCCAAATGGG + Intergenic
1050945998 9:11518585-11518607 CTGGTCTTTATAAGCAAAATTGG + Intergenic
1055898695 9:81210271-81210293 CAAGTTTTTATGAGACAAATAGG + Intergenic