ID: 963030594

View in Genome Browser
Species Human (GRCh38)
Location 3:140970954-140970976
Sequence CCGAGTCTTTATAAGCCAAA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 61
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 56}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963030594_963030596 -5 Left 963030594 3:140970954-140970976 CCATTTGGCTTATAAAGACTCGG 0: 1
1: 0
2: 0
3: 4
4: 56
Right 963030596 3:140970972-140970994 CTCGGTTACAGCTTGATGCAAGG 0: 1
1: 0
2: 0
3: 2
4: 48
963030594_963030597 22 Left 963030594 3:140970954-140970976 CCATTTGGCTTATAAAGACTCGG 0: 1
1: 0
2: 0
3: 4
4: 56
Right 963030597 3:140970999-140971021 TTAATTCCTTAAAATAAAATTGG 0: 1
1: 0
2: 5
3: 110
4: 988

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963030594 Original CRISPR CCGAGTCTTTATAAGCCAAA TGG (reversed) Exonic
901673307 1:10868229-10868251 CCCAGCCTTAATAAGCCAGAAGG + Intergenic
904388982 1:30167155-30167177 CTGAGTTTTAATAACCCAAATGG + Intergenic
910756675 1:90700922-90700944 CTTAGGCTTTACAAGCCAAAGGG - Intergenic
921075896 1:211699829-211699851 TTGATACTTTATAAGCCAAATGG - Intergenic
922443659 1:225677993-225678015 CCAAGCCTTTATAAGCCTTACGG - Intergenic
1068776767 10:60875705-60875727 CCCAGTCTTTAGAATCCAAGAGG - Intronic
1069399905 10:68032376-68032398 TGAAGTATTTATAAGCCAAATGG + Intronic
1072155617 10:92721102-92721124 CTGACTCTTTATAAGAGAAAGGG + Intergenic
1074125150 10:110522956-110522978 AGGAGTTTTTATAAGCCCAAAGG - Intergenic
1074576916 10:114678617-114678639 TTGAGTCTTTGTGAGCCAAATGG - Intronic
1078054172 11:7993739-7993761 CCAAGTCTTTATGAGCCAGTTGG + Intronic
1087601252 11:100318903-100318925 CCGAGACTTTATTTTCCAAAGGG + Intronic
1087952261 11:104237354-104237376 TAGAACCTTTATAAGCCAAAAGG + Intergenic
1092676070 12:10922076-10922098 CTGATTCTTTAAAAACCAAAGGG + Intronic
1102231950 12:111268739-111268761 CGGAGACATTATAAGCAAAAAGG - Intronic
1112496847 13:99911870-99911892 CCGAGAGTTTACAAGCCAACTGG + Intergenic
1112984588 13:105432267-105432289 CAATGTCTTTATAAGGCAAAAGG + Intergenic
1124985460 15:34606415-34606437 CAGTGTCTTTATAAGATAAATGG + Intergenic
1125685360 15:41560219-41560241 ACGAGTATTTACAAGCCGAAAGG + Intronic
1125788648 15:42345396-42345418 TTAAGTTTTTATAAGCCAAATGG + Intronic
1138162903 16:54773054-54773076 CCCAGTCTCTATGAGCAAAAGGG + Intergenic
1153271708 18:3329131-3329153 CCCAGTCTTTACAAGTGAAACGG - Intergenic
1159836592 18:73343890-73343912 CAGATTGTTTATAAGCTAAAAGG + Intergenic
1163194434 19:15705272-15705294 CAGAGACTTTATGAGCCAGAAGG + Intergenic
925103990 2:1273325-1273347 GGGAGTCTTTATAAACAAAAAGG - Intronic
931445652 2:62325038-62325060 CACAGTCTCTATAAGCTAAATGG + Intergenic
932956022 2:76351879-76351901 CCCACTCATTATAAGCCAGAGGG - Intergenic
936717051 2:115199393-115199415 CCGAGTGCTTAAAAGCCAATAGG - Intronic
944525701 2:200617029-200617051 TAGGGTATTTATAAGCCAAAGGG - Intronic
1170008109 20:11690894-11690916 TCAAGTCTGTATAAGCCAAAGGG + Intergenic
1170032072 20:11954480-11954502 CCGAGTATTTATCAGCCATGTGG + Intergenic
1179841659 21:44079908-44079930 CAGAGGCTTCAAAAGCCAAAGGG - Intronic
960379438 3:116941054-116941076 CAGAAACTTTATAAGCCAGAAGG + Intronic
963030594 3:140970954-140970976 CCGAGTCTTTATAAGCCAAATGG - Exonic
963332141 3:143926481-143926503 CTGTCTCTTTATAAGCAAAATGG - Intergenic
969037913 4:4270405-4270427 CAGAGTCTTTTTAGGGCAAATGG - Intronic
971519493 4:27531140-27531162 AATAGTCTTTATAAGACAAATGG - Intergenic
978868454 4:113544659-113544681 CAGGGTCTTAATAAGCAAAATGG - Intronic
980116349 4:128683078-128683100 CCGGGTCTTTGTGAGCCTAAGGG + Intergenic
981923612 4:150114721-150114743 CAGAAACCTTATAAGCCAAAAGG - Intronic
987058222 5:14216635-14216657 CAGAGTCTTTAAAAACCAAGAGG - Intronic
989179899 5:38565978-38566000 CAGAGTCTTCATAAGACAAAGGG - Intronic
991312872 5:65264203-65264225 CTGAGTTTTTTTAAGCAAAAAGG - Intronic
992367582 5:76109038-76109060 CCAAGTGTTTAAAAGCAAAAAGG - Intronic
993715312 5:91270095-91270117 CCCAGTCTTAATAATGCAAATGG + Intergenic
995077919 5:108009641-108009663 CTGAGTCTTTACAAGCCCAAGGG + Intronic
998210395 5:140192810-140192832 CCCAGTCTATCTAAGCCAATCGG - Intronic
1003978271 6:11364885-11364907 CAGTTCCTTTATAAGCCAAATGG + Intronic
1008418120 6:51266912-51266934 CAGAGTCATTATAAATCAAAGGG + Intergenic
1008536059 6:52507108-52507130 CCATGTCATTATAAACCAAAGGG + Intronic
1015598704 6:134891816-134891838 CCAACTCTTTATAAGGCCAAAGG - Intergenic
1017233396 6:152095944-152095966 TAGAGTCTTTCTATGCCAAAAGG + Intronic
1025825582 7:65008017-65008039 CCGAGGCTTCATAAATCAAAAGG - Intergenic
1025898589 7:65725831-65725853 CCGAGGCTTCATAAATCAAAAGG - Intergenic
1033320563 7:140335913-140335935 CCCAGTCTTTAGAAGCTAGATGG + Intronic
1043751829 8:83946492-83946514 AAGATTCTTTATAAGCTAAAGGG + Intergenic
1048358461 8:133673717-133673739 CTGTCTCTTTATAAGCCAAATGG + Intergenic
1055439078 9:76321183-76321205 CCCAGTATTACTAAGCCAAAGGG - Intronic
1193500503 X:82268183-82268205 CAGAATCTTTGCAAGCCAAAAGG + Intergenic
1194144200 X:90243553-90243575 CAGAAACTTTATAAGCCAGAAGG + Intergenic
1200489965 Y:3812861-3812883 CAGAAACTTTATAAGCCAGAAGG + Intergenic