ID: 963030596

View in Genome Browser
Species Human (GRCh38)
Location 3:140970972-140970994
Sequence CTCGGTTACAGCTTGATGCA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 51
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 48}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963030592_963030596 -3 Left 963030592 3:140970952-140970974 CCCCATTTGGCTTATAAAGACTC 0: 1
1: 0
2: 1
3: 9
4: 184
Right 963030596 3:140970972-140970994 CTCGGTTACAGCTTGATGCAAGG 0: 1
1: 0
2: 0
3: 2
4: 48
963030594_963030596 -5 Left 963030594 3:140970954-140970976 CCATTTGGCTTATAAAGACTCGG 0: 1
1: 0
2: 0
3: 4
4: 56
Right 963030596 3:140970972-140970994 CTCGGTTACAGCTTGATGCAAGG 0: 1
1: 0
2: 0
3: 2
4: 48
963030593_963030596 -4 Left 963030593 3:140970953-140970975 CCCATTTGGCTTATAAAGACTCG 0: 1
1: 0
2: 0
3: 4
4: 55
Right 963030596 3:140970972-140970994 CTCGGTTACAGCTTGATGCAAGG 0: 1
1: 0
2: 0
3: 2
4: 48
963030591_963030596 1 Left 963030591 3:140970948-140970970 CCAACCCCATTTGGCTTATAAAG 0: 1
1: 1
2: 1
3: 15
4: 185
Right 963030596 3:140970972-140970994 CTCGGTTACAGCTTGATGCAAGG 0: 1
1: 0
2: 0
3: 2
4: 48

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963030596 Original CRISPR CTCGGTTACAGCTTGATGCA AGG Exonic
905611853 1:39359622-39359644 CTTGGCTACATCTTGAAGCATGG - Intronic
907671978 1:56483443-56483465 CTCTCTTTCAGCTTGATTCATGG - Intergenic
914352142 1:146849695-146849717 CTGGGTTACCACTTGGTGCATGG - Intergenic
915800910 1:158792426-158792448 CTAGGTAACAGCATGATGCCTGG - Intergenic
1075462179 10:122624159-122624181 CTCGGTTGCATCCTGCTGCAGGG + Intronic
1078932551 11:15923451-15923473 CTCTGGTTCAGCTTGATGGATGG - Intergenic
1079698691 11:23517529-23517551 CCCAGTGACAGCATGATGCAGGG - Intergenic
1080415908 11:32069996-32070018 TTCAGGTACAGCTTGATCCAGGG + Intronic
1094709558 12:32947876-32947898 CTAGGTTACAGTGTGATGCATGG + Intergenic
1096096759 12:48940579-48940601 CTTGGTTACAGTTTGCTGAAGGG - Intronic
1104664343 12:130636796-130636818 TTCAGTTACAGCTTGATCCAGGG - Intronic
1108876763 13:55058047-55058069 CTCGGTCACAGCTTGGTGGGTGG - Intergenic
1110817772 13:79880611-79880633 GTCAGTTACTGCTTGATGGATGG - Intergenic
1115050741 14:29059634-29059656 CTTGCTTACATCTTGATACATGG - Intergenic
1115322508 14:32098922-32098944 CTCGGTTACAGTGTGAAGAATGG + Intronic
1116101821 14:40447966-40447988 CTTGATTAAAGCTTGATGCCTGG - Intergenic
1118635219 14:67742704-67742726 CTTGGACATAGCTTGATGCATGG + Intronic
1119980574 14:79076384-79076406 CTCGGTTGCAGCCTTATGGAGGG - Intronic
1123937984 15:25203180-25203202 TTCGGATACTGCTGGATGCATGG + Intergenic
1125192192 15:37006464-37006486 CTCCATCACAGCTTGATCCATGG + Intronic
1127529518 15:59829900-59829922 CTAGGTTACAGCCTTCTGCAAGG + Intergenic
1129603300 15:77012541-77012563 CTCAGGTACAACTTGATGGATGG - Intronic
1132539288 16:500907-500929 CTGGGTTGCAGCTTCATGCCTGG + Intronic
1135499459 16:22981198-22981220 CTCACTTAGAGCTTGGTGCATGG + Intergenic
1135885801 16:26306322-26306344 TTCAGGTACAGCTTGATCCAGGG + Intergenic
1139981888 16:70865837-70865859 CTGGGTTACCACTTGGTGCATGG + Intronic
1140978160 16:80080844-80080866 CTCTGCTACAGTTTGAGGCAAGG - Intergenic
1142424165 16:89992113-89992135 CGTGGTCACAGCTTGATGCTGGG - Intergenic
1156642136 18:39115195-39115217 TTCAGTCACAGCTTGATGTAGGG - Intergenic
933459727 2:82566863-82566885 CTTGGTTACAGATAGCTGCAAGG + Intergenic
934504307 2:94879267-94879289 CCCAGTAACAGGTTGATGCAGGG + Intergenic
1173236210 20:41247930-41247952 CTCTGTAAGAGCTTGAAGCAGGG - Intronic
1174148110 20:48466623-48466645 CATGGTCACAGCTTGCTGCAAGG + Intergenic
1174202006 20:48813115-48813137 CTGGGATACAGCAGGATGCAGGG - Intronic
1178135872 21:29626550-29626572 CTTGGTGACACCTTGATGCTGGG + Intronic
963030596 3:140970972-140970994 CTCGGTTACAGCTTGATGCAAGG + Exonic
968681660 4:1925142-1925164 CTAGGTTACAGATGGAAGCAGGG - Intronic
975476756 4:74832486-74832508 CTCAGTTCCAGCTTTATTCACGG - Intergenic
975971761 4:80047817-80047839 CTCAGGTACAGCTGGATCCAAGG - Intronic
986757589 5:10852659-10852681 TTCAGGTACAGCTTGATCCAGGG - Intergenic
996063356 5:119055664-119055686 CACTGTTACAGCATCATGCAGGG - Intronic
1002700931 5:181124418-181124440 CTCATTTACAGCTTGAGGAATGG - Exonic
1005343126 6:24862266-24862288 CTCCATTGAAGCTTGATGCAGGG + Intronic
1013379830 6:109557310-109557332 CTCGGTAACATCTTCAGGCATGG - Intronic
1013483210 6:110569727-110569749 CTCTGTTACAGACTGAAGCAGGG + Intergenic
1021939089 7:25661910-25661932 CTAGGGTATAGCTTGATGAAAGG + Intergenic
1033898637 7:146107966-146107988 CTCAGTTTCAACTTGCTGCATGG + Intergenic
1054883716 9:70173028-70173050 TTCAGGCACAGCTTGATGCAGGG + Intronic
1061531075 9:131213560-131213582 CTGTGTTTCAGCCTGATGCATGG + Intronic
1197137120 X:123074436-123074458 CTCAGGGACAGCTTCATGCAGGG + Intergenic
1201548226 Y:15189851-15189873 CTCGTTTGCACCTTGATGAAGGG - Intergenic