ID: 963034908

View in Genome Browser
Species Human (GRCh38)
Location 3:141017568-141017590
Sequence AGCAATCAGCAGGATGTGGT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963034904_963034908 24 Left 963034904 3:141017521-141017543 CCAATCAGCACTCTGTAAAATGT No data
Right 963034908 3:141017568-141017590 AGCAATCAGCAGGATGTGGTCGG No data
963034905_963034908 0 Left 963034905 3:141017545-141017567 CCAATCAGCTCTCTGTAAAACAA 0: 6
1: 366
2: 379
3: 1579
4: 3392
Right 963034908 3:141017568-141017590 AGCAATCAGCAGGATGTGGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963034908 Original CRISPR AGCAATCAGCAGGATGTGGT CGG Intergenic
No off target data available for this crispr