ID: 963038303

View in Genome Browser
Species Human (GRCh38)
Location 3:141051151-141051173
Sequence GCGCCCCTGTGCCAAGGCGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963038303_963038311 12 Left 963038303 3:141051151-141051173 CCGCCGCCTTGGCACAGGGGCGC No data
Right 963038311 3:141051186-141051208 CACTTCCCTCTCCCGCCAGCTGG 0: 1
1: 0
2: 2
3: 28
4: 281
963038303_963038317 26 Left 963038303 3:141051151-141051173 CCGCCGCCTTGGCACAGGGGCGC No data
Right 963038317 3:141051200-141051222 GCCAGCTGGTGGCCTCGAGAAGG 0: 1
1: 0
2: 0
3: 12
4: 165
963038303_963038319 29 Left 963038303 3:141051151-141051173 CCGCCGCCTTGGCACAGGGGCGC No data
Right 963038319 3:141051203-141051225 AGCTGGTGGCCTCGAGAAGGTGG 0: 1
1: 0
2: 2
3: 27
4: 293
963038303_963038312 15 Left 963038303 3:141051151-141051173 CCGCCGCCTTGGCACAGGGGCGC No data
Right 963038312 3:141051189-141051211 TTCCCTCTCCCGCCAGCTGGTGG 0: 1
1: 0
2: 4
3: 25
4: 290

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963038303 Original CRISPR GCGCCCCTGTGCCAAGGCGG CGG (reversed) Intergenic