ID: 963038346

View in Genome Browser
Species Human (GRCh38)
Location 3:141051288-141051310
Sequence CCCGGCGACCGCGCCTTCCG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 75}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963038340_963038346 9 Left 963038340 3:141051256-141051278 CCGGGGCGCGGGATGGTGGGGGA 0: 1
1: 0
2: 2
3: 21
4: 267
Right 963038346 3:141051288-141051310 CCCGGCGACCGCGCCTTCCGCGG 0: 1
1: 0
2: 0
3: 5
4: 75
963038332_963038346 23 Left 963038332 3:141051242-141051264 CCGAGCTGGGACGGCCGGGGCGC 0: 1
1: 0
2: 3
3: 16
4: 163
Right 963038346 3:141051288-141051310 CCCGGCGACCGCGCCTTCCGCGG 0: 1
1: 0
2: 0
3: 5
4: 75
963038331_963038346 24 Left 963038331 3:141051241-141051263 CCCGAGCTGGGACGGCCGGGGCG 0: 1
1: 0
2: 2
3: 25
4: 185
Right 963038346 3:141051288-141051310 CCCGGCGACCGCGCCTTCCGCGG 0: 1
1: 0
2: 0
3: 5
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963038346 Original CRISPR CCCGGCGACCGCGCCTTCCG CGG Intergenic