ID: 963040206

View in Genome Browser
Species Human (GRCh38)
Location 3:141064830-141064852
Sequence GTCTGGTTTCCTAGTGATGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 114}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963040196_963040206 15 Left 963040196 3:141064792-141064814 CCAGGGCCCGTCCAAGTAGTCCG 0: 1
1: 0
2: 0
3: 2
4: 23
Right 963040206 3:141064830-141064852 GTCTGGTTTCCTAGTGATGGTGG 0: 1
1: 0
2: 1
3: 8
4: 114
963040202_963040206 -5 Left 963040202 3:141064812-141064834 CCGAGCTCCTTGGGTTCTGTCTG 0: 1
1: 0
2: 4
3: 16
4: 231
Right 963040206 3:141064830-141064852 GTCTGGTTTCCTAGTGATGGTGG 0: 1
1: 0
2: 1
3: 8
4: 114
963040197_963040206 9 Left 963040197 3:141064798-141064820 CCCGTCCAAGTAGTCCGAGCTCC 0: 1
1: 0
2: 1
3: 5
4: 85
Right 963040206 3:141064830-141064852 GTCTGGTTTCCTAGTGATGGTGG 0: 1
1: 0
2: 1
3: 8
4: 114
963040200_963040206 4 Left 963040200 3:141064803-141064825 CCAAGTAGTCCGAGCTCCTTGGG 0: 1
1: 0
2: 50
3: 898
4: 3213
Right 963040206 3:141064830-141064852 GTCTGGTTTCCTAGTGATGGTGG 0: 1
1: 0
2: 1
3: 8
4: 114
963040195_963040206 16 Left 963040195 3:141064791-141064813 CCCAGGGCCCGTCCAAGTAGTCC 0: 1
1: 0
2: 0
3: 2
4: 43
Right 963040206 3:141064830-141064852 GTCTGGTTTCCTAGTGATGGTGG 0: 1
1: 0
2: 1
3: 8
4: 114
963040194_963040206 21 Left 963040194 3:141064786-141064808 CCATACCCAGGGCCCGTCCAAGT 0: 1
1: 0
2: 0
3: 7
4: 97
Right 963040206 3:141064830-141064852 GTCTGGTTTCCTAGTGATGGTGG 0: 1
1: 0
2: 1
3: 8
4: 114
963040198_963040206 8 Left 963040198 3:141064799-141064821 CCGTCCAAGTAGTCCGAGCTCCT 0: 1
1: 0
2: 1
3: 8
4: 129
Right 963040206 3:141064830-141064852 GTCTGGTTTCCTAGTGATGGTGG 0: 1
1: 0
2: 1
3: 8
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963040206 Original CRISPR GTCTGGTTTCCTAGTGATGG TGG Intronic
900602091 1:3507115-3507137 GGCTGGTTGCCTGGTGGTGGTGG - Intronic
901784289 1:11614324-11614346 TGCTGGTTTCCTATTTATGGTGG + Intergenic
902571549 1:17350274-17350296 TGCTGGTTTCCCATTGATGGTGG - Intronic
903841296 1:26243289-26243311 TTCTGGTTTCACAGTGATGGTGG + Intronic
905024188 1:34838496-34838518 GTCTGGGGTCCTAGAAATGGGGG + Intronic
905358538 1:37402181-37402203 CTCTGGGTACCTAGTGCTGGTGG + Intergenic
906670119 1:47648201-47648223 GTCTCGTTTCCTGCTAATGGAGG - Intergenic
915251176 1:154589794-154589816 GTCTTTTTTCATAATGATGGCGG + Exonic
915269996 1:154747089-154747111 GTCTGGTGTCCTAGTGTGGCTGG - Intronic
915955308 1:160215796-160215818 GTCTGTGTTCCTATTGCTGGTGG - Exonic
916877521 1:168985546-168985568 ATTTGGTTTGCTGGTGATGGAGG + Intergenic
1064732932 10:18350795-18350817 GTTTGGTTTTTTAGTGGTGGTGG + Intronic
1064981390 10:21170890-21170912 TTCAGGTCTCCTAGAGATGGAGG - Intronic
1068736350 10:60417441-60417463 GCCTGGTTTCCTGGGAATGGAGG + Intronic
1071788759 10:88932483-88932505 GTCTGGTTTGCTATTGTTAGAGG + Intronic
1073522874 10:104150891-104150913 GTCTGGTTTCCTGAGGGTGGTGG - Intronic
1074432199 10:113403791-113403813 GACTATTTTCCTACTGATGGGGG - Intergenic
1075502555 10:122989161-122989183 GTGTGGTTGCTTAGAGATGGGGG + Intronic
1080959605 11:37142892-37142914 GTCTGGTTTTCTAGTTGTGTAGG + Intergenic
1083827334 11:65211097-65211119 CTCTGGTTTCCCAGGGGTGGAGG + Intronic
1086560424 11:88162125-88162147 GGCTGACATCCTAGTGATGGTGG + Intronic
1087185864 11:95194272-95194294 CTCAGGTTACCTAGTAATGGGGG - Intronic
1088569735 11:111211995-111212017 ATTTGGTTTCCTAGGGGTGGGGG - Intergenic
1094263379 12:28527314-28527336 TTCTCCTTTCCTAGGGATGGGGG + Intronic
1096352952 12:50915659-50915681 CTCTGATTTCCTTGAGATGGGGG + Intergenic
1097072393 12:56364665-56364687 TTCTGGTTTCCTTGTGATTCTGG - Intergenic
1097400183 12:59118976-59118998 GTGTGATATCCTAGTGATGGCGG - Intergenic
1098039499 12:66339807-66339829 ATCAGGTTACCTAGGGATGGGGG - Exonic
1099228580 12:79997058-79997080 GTCTGCTTTCCAAGTTATTGTGG - Intergenic
1101340711 12:103840467-103840489 GTCTGTTTTCCTTTTGGTGGGGG - Intronic
1102944459 12:116973929-116973951 GTCCGGTTTTCTAGTTAAGGTGG - Intronic
1104612087 12:130237151-130237173 GCCTGATTTCCTAGTGAAGGGGG + Intergenic
1104650411 12:130527302-130527324 TTCTGGTTTCCCAGTGTCGGGGG + Intronic
1106793050 13:33175713-33175735 ATCTGACTTCCTAGTGGTGGTGG - Intronic
1107242898 13:38258874-38258896 CTCTTGTATCCCAGTGATGGAGG + Intergenic
1108404946 13:50091596-50091618 GTGTGGTTTTATAGTCATGGTGG + Intronic
1108746105 13:53396270-53396292 TTCTGGTTTCCTAATGATCATGG + Intergenic
1109380288 13:61550642-61550664 GTCTTGTTTTCTAGTGGTAGGGG - Intergenic
1111864627 13:93753189-93753211 GTCTCGTTACTTAGTGTTGGCGG + Intronic
1112801270 13:103112342-103112364 GCCTGGTTTCCTAATGACTGTGG + Intergenic
1113353164 13:109549518-109549540 CTCTGGTTTCCTTATGCTGGTGG - Intergenic
1115529786 14:34316637-34316659 GTCTGGGTTCCAAGAGGTGGAGG - Intronic
1117010451 14:51465448-51465470 CTATGGTTACCTAGAGATGGCGG - Intergenic
1119066247 14:71530005-71530027 GGCTGGTTTCCTTGTGATTCTGG - Intronic
1121695216 14:95906906-95906928 GACTGGTTCCCTAGAGGTGGTGG - Intergenic
1122946870 14:105015421-105015443 GGCTGGTTTCCGACTGATGGCGG - Intronic
1125103490 15:35943235-35943257 GCCTGGTCTCCTAGTGCTGTAGG + Intergenic
1134709622 16:16321482-16321504 GCCTGGCTTCCCAGTGAGGGCGG + Intergenic
1134780780 16:16893309-16893331 GTATTATTTTCTAGTGATGGAGG + Intergenic
1136299427 16:29323751-29323773 TTCTGGTATCCTAATGATGCAGG - Intergenic
1138460046 16:57142685-57142707 GTCTGGTGTCCCAGTGGAGGGGG + Intronic
1139562067 16:67749424-67749446 CACTGGTTTCCTGGTGATGGCGG - Intronic
1139652332 16:68368637-68368659 GTCTGGTTTGCGAGTGAATGGGG + Intronic
1144380256 17:14687925-14687947 GTCTCTTTTCCTAGCAATGGTGG - Intergenic
1144410883 17:15000642-15000664 TAGTGGTTTCCTAGAGATGGGGG + Intergenic
1145779660 17:27553868-27553890 GTGTGGAAGCCTAGTGATGGGGG + Intronic
1149320610 17:55477233-55477255 GTATTGTTTCATAGTTATGGAGG + Intergenic
1151986491 17:77547323-77547345 GTGTGGTTTCCTGGTGCTAGGGG + Intergenic
1153784428 18:8522046-8522068 GTCTGATTTCCCAGTGATAAGGG - Intergenic
1155925524 18:31651556-31651578 GTCTGTTTTCCTAGTAAAGCAGG - Intronic
1156334984 18:36162230-36162252 AAGTGGTTTCCTAGGGATGGAGG - Intronic
1159022948 18:63157860-63157882 GTCCGGTTTCAGAGTGATGAGGG + Intronic
1159261479 18:66017865-66017887 GTCTGGTTTCCTAGCCTTGGAGG + Intergenic
1160221672 18:76982526-76982548 ATGTAGTTTCCGAGTGATGGGGG + Intronic
1163760703 19:19134938-19134960 GCCTGGGTTCCTAGGGAGGGAGG - Intronic
1164726991 19:30472524-30472546 GGCTGGTTTACACGTGATGGAGG + Intronic
925093411 2:1173600-1173622 GTCTGGTTTTCTTGGGAGGGTGG - Intronic
926117894 2:10224805-10224827 GACTGGTTTCCTTGTGAGAGAGG + Intergenic
926843951 2:17113112-17113134 CTCTGGAGTCCCAGTGATGGTGG - Intergenic
929111297 2:38407327-38407349 GTGTGGTTCCCTACTGGTGGTGG + Intergenic
930497648 2:52168715-52168737 TTTTGGTTTCATAGTGATGGTGG + Intergenic
932668744 2:73718893-73718915 GTCTGTCTTCCTAGAGTTGGTGG - Intergenic
937987683 2:127645834-127645856 GGATGATTTCCTACTGATGGGGG - Intronic
938735871 2:134186264-134186286 CTGTGCTGTCCTAGTGATGGGGG + Intronic
942185575 2:173421814-173421836 GTCTGGTTTGCTAGGGACTGTGG - Intergenic
942754800 2:179328009-179328031 AACAGCTTTCCTAGTGATGGTGG - Intergenic
945286889 2:208091647-208091669 GTCTGTGTTCCTAGTGAATGAGG + Intergenic
946345599 2:219107894-219107916 ATCTGGTTTCCTAGTGTTGGTGG - Intronic
1168855703 20:1006142-1006164 GTCTGGTTTGCCAGGGATTGAGG + Intergenic
1175780954 20:61681792-61681814 CTTTGGCTTCCTGGTGATGGAGG + Intronic
950157833 3:10737119-10737141 GTGTGGTTTCCTAGGGCTGGGGG + Intergenic
951406495 3:22306137-22306159 TTCTGCTTGCATAGTGATGGGGG + Intronic
956399743 3:68864936-68864958 CTGTGGTTGCCTAGGGATGGTGG + Intronic
959121819 3:102241838-102241860 TTATGTTTTTCTAGTGATGGTGG + Intronic
963040206 3:141064830-141064852 GTCTGGTTTCCTAGTGATGGTGG + Intronic
969186460 4:5478250-5478272 CTCTGGTTTCTGAGTCATGGGGG - Intronic
971706861 4:30056262-30056284 GTCTGGTTTCATAGTTAGGCTGG + Intergenic
971838315 4:31798730-31798752 TTCTGGTCTTTTAGTGATGGTGG + Intergenic
972280319 4:37595973-37595995 CTCTTGGCTCCTAGTGATGGGGG + Intronic
973623854 4:52751767-52751789 GTCTGGCTTCCTAGGTCTGGCGG + Intergenic
974405749 4:61466467-61466489 GTCTGGTTTGCTAGAGCAGGAGG + Intronic
975036688 4:69693213-69693235 TTCTGGTATCATAGTGATGCAGG + Intergenic
976377110 4:84358323-84358345 GTCTGGTGTCTTAGTGCGGGTGG + Intergenic
977917637 4:102611920-102611942 GCCTGGTACCCTAATGATGGAGG - Intronic
978384438 4:108166804-108166826 GGTTTGTTTCCAAGTGATGGCGG + Intronic
981527966 4:145725753-145725775 GAGTGGTTTTCTAGTGCTGGTGG + Intronic
985198410 4:187458659-187458681 GTATTTTTTCGTAGTGATGGGGG + Intergenic
989781555 5:45271336-45271358 GTCTGGTTTCCTGCTGATTCAGG + Intronic
990317418 5:54596323-54596345 GTCTGTTTTGGTAGAGATGGTGG - Intergenic
998004842 5:138649934-138649956 GCCTGGTCTCCTAGGGAAGGAGG + Intronic
998575589 5:143312149-143312171 TTCTGGTTTTCTATTTATGGTGG + Intronic
1001697891 5:173685906-173685928 GTGTTGGTTCCTAATGATGGTGG - Intergenic
1002760174 6:195781-195803 TTCTGGATTCCTACTCATGGAGG - Intergenic
1005218688 6:23561644-23561666 GTTTTGTTTCATAGTGAGGGTGG - Intergenic
1005691617 6:28312021-28312043 TTCAGGTTCCCTAGTGACGGTGG + Intergenic
1021180837 7:17503939-17503961 TTCTGGTTTCTTAGTGACTGTGG + Intergenic
1022907125 7:34868247-34868269 GGCTGGCTTTCTAGTGAAGGGGG - Intronic
1024522427 7:50317527-50317549 GTCTGGCTTCCGTGTGCTGGTGG + Intronic
1025162762 7:56678870-56678892 GCTTGGTTACCTAGTGATGTTGG + Intergenic
1028249410 7:88523275-88523297 ATCTGGTTTGCTAGAAATGGAGG + Intergenic
1034610487 7:152363491-152363513 GTCTGGTTTCCTAGTTGTTTGGG - Intronic
1035912762 8:3585994-3586016 GTATGTTTTCATAGTGATGTGGG - Intronic
1038132513 8:24748795-24748817 GGCTGGTTTTTTGGTGATGGTGG - Intergenic
1041253662 8:55959988-55960010 GACTGGTTGCCTAGGGCTGGGGG + Intronic
1047294046 8:123555447-123555469 GTCTGGTTTCCAGTTGATGTTGG + Intergenic
1047402210 8:124556836-124556858 GGCTGGTTTCCTGGGAATGGAGG - Intronic
1048153187 8:131914337-131914359 GTTTGGTCTTCCAGTGATGGGGG + Intronic
1052415740 9:28174850-28174872 GTCAGATTTCTTAGAGATGGGGG + Intronic
1057081592 9:92177948-92177970 GCCTGCTTCCCTAGTGATGTGGG - Intergenic
1058073177 9:100622484-100622506 GTCTGTTTTTGTAGAGATGGGGG - Intergenic
1187794318 X:22985558-22985580 TAGTGGTTTCCTAGTGCTGGGGG - Intergenic
1195048909 X:101079361-101079383 TTCTGGTTTACTTGGGATGGGGG - Intronic
1196342249 X:114608424-114608446 TACTGGTTGCCTAGTGCTGGGGG - Intronic
1198724234 X:139659818-139659840 GTCTGTTTTCATATTGGTGGTGG - Intronic